Description :
From Genome Similarity Track
Location :
Scaffold_1960:2109- 3294
Transcript NameFunction/comments
Phyta_totarag13928hypothetical protein PHYSODRAFT_494903

Sequence
1185 bases(100 bases per row)
TCCATCAACGCCTTGAAAATGGCCGACGAGTGGGAAGCAGTCGTGTTTGTGAACACATTGTACCCGAACAAGTTCTGCGCGCTGTCGCCGTACACCAAGT
AGCCGCCGTACTGGCCCTCTACAAGATCAGCACCCTTGCCATATCCACGACTGTAGAGATTTTGACCCATTGCTAGCGTGTAACCGGTGGCCCCGCTTGC
GTTGATGGTAGGGTCCGTGTAGGTCACGCCAAATACAGTCGGCGAGTTGGAGTCAAACGCTGGCTCTGCAATCGAGAGCGTCTGTGCATTGGCACCGGAG
TAATAGGACGATGCCATCACTTCGCTGCACcattctccagctcctgctccagcttggcaGAAGTATGGCGTCGGGGTCGCACTGCCGGAGTACGCGTCGG
TCATCAGAGCCTTCAGTGGGTCATCGTTAATTGCCATGCTGCCCTTGAGGATCCCCAACCCAGCGGCAATAAGCAAAATAGGCAGCGCAGCGACATAGAT
GATCGCCTTCTTGTCCCGCTTGGCATGACGGAAACGCTTCAGCAGTAGTGCACGCAAGTGTCTCCGGAATATCGACTCCGTCGTAATGATCTCGTCACAC
GGCTGGTAGTACTCACCGGAACCCGACGTGTTGGTTCGCACGTTGTTGCCCAGTGTATGCTGGTTGTTCTCGTCTGAGAGTTCTGCCACCTTGATGAACA
CTTCTTCCAGCGTGGTCACAGACACACCATACGACAAGAGACCCAAAGTCTGCAACTGACGATCCATTTCAGCGAACATAGTGGCAAAGCTCGAAGAACT
GTGCAGAGGCAGTTGGAACGCGATTTCACTGCCGACGTTGCTCAGTTGCTGGGCGGCGGGCACGTACGATTTCACAAAAGAAGCCACCGCATCATCGTCG
cacttggcgtcgtccttcACGAGAGTCAGGTTGTAGCCTGCACCGAAGCGGTTCTTCAGGAACAGCGACGAACCGCAGCAACGCATCTCGCCTTCAACCA
TGATAGCAATCCGGTCACCCAGAATGTCGGCCTCATCCATGAAGTGCGTCGTCAGCACCATCACGCGGTCGTTGCGGTTGTTCAGCAGAATTTCCCACGT
GCTACGGCGACTATAAGGGTCCATGCCGGAAGTGGGCTCATCGAGGAACACCAGCGAGCTGTCGCCCAGTAGCGACACGGCCACC