Description :
From Genome Similarity Track
Location :
Scaffold_2:2108898- 2115328
Sequence
6430 bases(100 bases per row)
GGGCGCTGTTGTTAACAACAGCGCTCGTATTACTTTCCAGCGTGTAGCGCATGGTGGGCTTCGTACGTCCTCACCATGTCCGGGACGTCTTCGAGCAAGA
CGTTCCGCGGCTCCCATGTATCTTGGTTGGGAGGGAATCCTCTCCAACGAATACGAAAACGAACCGGTTGCCTGTTCGTTCTCGGGATACTGTGACCATC
AATCCGCTCAACTATCCATCGAGTTGAGCCGTGTGCGTCACGAATTGGCGGTGGTGGTGGTGGAAACACGCCTCGTGTGTGGTCAACTTGGTGTTGACCC
TGATGTCGCGTCTCCCCACGACCGAGTTCCGGTCGTGGAGTAGTTCCAGAGCGCTGGGTTTGGCGCTCTGAAGTATTCTCAGGTTGCGGCGGCCTCCCAG
GCCGCCTCGATCGTTCCGGCCGAGCTGGAACATTAGCTCGACCCACTGCTCCAGCGCGACTTCGCGCTGGTGAGGATGACGGCTTCCGCCGAGTCTTCTG
CTTCGGTTCAGCCGAGTTAGGTAGCTCGTACTGCAGGTATGGCTTCAGCCGTCCGACGTAGAACGTCGGATGGAGGCGCATACTAGATGGTATGTCCAGT
GTGTTGGCGTTGCCGTGCCGTGCCAGCACAGTGAACGGCCCGATGAAGCGCGGAGCGAGCTTGCTCGCCCCGAAGTCGGAAACTGCATGTTTAGGCAGGT
TTTGAGTAGCTAACAAAACCAATGAACCCTTCTTGAATTCATTTGTGTCGCTCCTGCCAACGTTGTCTGCGTTCAGCTTCTGTCGATCAACAGAAGCTGC
AATAGCGTCTTGGACAAACCGAATGACGGCTTGTCTGCGCTGCACGAAGTTGATTGCGTCCGAGCTGAACTCGTTCAGCTCGTTTTCAGCAGTAGGCCCG
GCCTCTGTGTTCGTCTTCGCGGTGTCTGTGCCCTGCACAGACCCGTTCTTCTTCTTCTTTTTGCTCTTGTCGGCGTCTGTGCCCTGCACAGACGCGTGCT
TCTTCTTGTTGTTGCGCGTAGTCGCGGCTGACACTGTGCAAGTGTCAGCAGCATTCTGCGGCTGCTGCGTTGCAGTCAGAGATCCTCCCCCACTTAAGGA
AGGAGCCACCATCCCGAGTAGACTCGGGAGGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTATGCCCAGTCGAGACATGCACCGAGTTGTTGATG
GCGAACTCCGCCATCGGCAGACACTCGCTCCAGTGTTGGAACGAGGGAGCGTAGCTCTTAAGCACGTCTACGAGCACGCGGTTCACGCGCTCGGTCTGCC
CGTCCGTCTGCGGATGGTCCGCAGTCGACATCGAAAGTTGACTCCCAAGAAGTGAAAACACTTCTTGCCAGAGATGCGCAGTGAAGCGCGGGTCTCGATC
CGACACTATGTCGATCGGCATGCCATGGTGTTTGAACACCATGTCAACGAACAGACGCGCCGTCTGCTTCGCAGTCACTTCAGCGGGTACCGCAGCAAGA
TGTACCATCTTGCTAAAGCGGTCAACAAAGACCACAATGCCCGTGTTCCTCTGGCTGTCCGGGGGAAGACAGAACACGAAGTTCAAAGACATGGACTGCC
AACACTCCCGTGGAGTTGGTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCAC
CTATTTATACTGGTGGGCCCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATACTCATAC
ATGATCCTGAGTCGCACGTCATGGTCATTGGGCACGACAACGCGGTCCGCGTTGTCGTCGGCTGCACTGTAGAGTAATAACCCGTCGTGCACCCGGTAAC
GGTGTGCACGAGCACGAAGATGCTTCGGCAGCTTCTGACGAGCTTGGTCAGAAGGCGCTGAGCCGTAGGCCAGCAAGTGCTTCGCGTCCGCGTCGTGCGC
GGACGCGACCTTCACGTCGTCCAACAGTGATGATCGATCGCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACGCGAGAG
CGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGTGAAGAATGAGAGCCATCTCGCCATCCGTTACGAGATGTGC
GGCGACTTCACAGCCGTCCGCAGCGACGCGTGGTCCGTATAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGAGTGCGTATTTCA
TGGCAAGGAGTTCCTTGTCATGTACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGACCACACGATCACGACCCTCGTGATCTTG
CTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCACACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAG
CCCCGCTTGAGTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATGATGCCCGCGT
AGTCCTTCACGTACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTGGACGGCGTCGGCCACTCATTGATCACTCTGACCTT
CTCAGGGTTAGGGTGGACACCGTTCTTCCCAACGAGACACCCGAGAACGGGTATCTCGCTCGCCCCGAAGATGCATTTCTTCAGGTTCGCATAGAGCTTG
TGCTTGCGCATGAGCGCAAACAGCTTCCGGAGATGCACCATGTGCATCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTATGGACGAACACATCGTCGA
AGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTACGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGTGGCATCACTAGCCA
CTCCCAGAGCATGCCGCTCGGCGTGCTCACAGCCGTGAGAGGGATATCGCTCTCACGCATGAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTG
TAGATAGTGCTCCTGGCCATCGAATCGATGATTACATCTTTTCGCGGTATTGGTGTCTGCGCTGTTATCGTCGCATCGTTCAGCTTGTTGTACGCATGAA
CGATGTGCCAGCCGCCCTGTGGTTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCTTTGCGACGACTCTCAAA
GAAGTCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTCCCCGGCACGAGATCAATCTCGTGCTGGATGCCC
TTGTCCTGCGGAAGCTCCGCAGGGATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTAAGATCTCGTAGTAGGGACTCGTCTTCAACGAGTCCCAGCTCT
GCTCTTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGCCGTCGCTCTCAGTGGTGGTCTCCATAATGAACTGCCTCAGTTCTTCATTCTCGCTCTT
CGTTCTCTGGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAAC
TCCGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCGCAGGTACGCGTCAAGACGTTCAACGTCTCGACGTCCGGCTTCT
CTGCCTCCGTCTGCCCGGGAGACATTTCTTGTAGCGTCTCGGCCAAGGCCGAGACTTGCGCAGCGACCTTCGCATGCGCCGTCTTCTTGTCCTGTGGAGC
CCGGCTCCGCATGACTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTTCAGTACCGCCGGCGGGTACGTCCCGCGGGCGAGTGACTTCAA
GCCCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAGCATGCAAGTTGTTCCGGTGCGGGACGTTTGCAACCGTCCGCACCGCCTGC
AGCGTCGACTCCCGGAGTCGACACGCCATCTTTACCTCGACGCCTGTTATTGGCGGAGCCCTTTATTACAAGGGGTGCGTCAACTCCCGGAGTCGACGCG
AAATTCCTTTTCGCAGCGCCGGTTCCCGGAACCGTCGCGACTTTAATACCTCGACGCCAACCATTGGCAGAGACCCCCATTAGGTAGGGTGCGTCGGATC
CCCGAGCCGACGAATCAAATTCGTCCAAGCTATCGACTCCCGGAGTCGATGTGACTTTAATACCTCGACGCCAACCATTGGCGGAGACCCCCATTACGTT
GGGTGCGTCGGCTCCCCGAGCCGACGAATCAAATTCACCCAATCCATCGACTCCCGGAGTCGACGGCGCTTCGTCACCTTGGCTCTTATTATTGGCTAAA
ACTGATCCAATCAGATTCGCGTCAGCCTCCACGGCTGAGGCGTGCGACTCGCTTGCGTCATCCGTGCCCCTTGAGCTCGGAGACTCTTCCTGATTCGCTG
AAAAGCAGGTGTCGATCTCCGAGATCAACACATTTTCTCCTTCAGCCGTCGGCGGCGACGCCGACGCTTGCTGCTCTTGCGCACGTGCTCGCGCGCGCCC
AGGGCACTCCGGGACAGCGGCATTAGGCGCTGTCTCGAGTGGGGAGTCGTGCGCACCTGTCGGTGCGTGCGTAGCAGCAACAGGGCCATCGCTCACTGTT
CCGCTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTCCCAATCGATGTCCGGATCATGCCGTGCAAGCCACGGCATGCCCAATACAATGTCAAACTTAT
CGTCCAGATCCAGGACGATAAAGGTCTCGACAAACTCTTGATCTTCATACGTGAAGCACACGCTTCTCGGTTTTAACGATGGCACCTGTTGCCAATCGAA
CTTCCAACATACTTCGAGGTATAATTGCCTCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTGTTCGACGCGCCCGAATCAACCAAAGC
ACGAAGAGAGTTGCTCTCTCTCTTCGAAGACACGTCCAAGATGACAAGGTTCGGTTTGTCATCATGCATTTTGCAGTGAGAAGGGTTCTCACTGGGGGCT
GCAGTCCTCAGTGTCACATGTCCGAGTTGGACACGCGTGACTGCTTCACCAGTAGGGCGCCCCGCGCCTACTGGGTTCCAGCGTTGTTTGTTTGTCCGCG
ACGATGCCCGGCATCGCCGCGTCGACCACCATCTCGGTGCACGGGTGCCGTGCACTCTCGGGCATAGTGACCGATCCTTCCGCAACGGAAGCATCGTACA
TTACTTCCTTGTTGTTGTTGATAATCAGCAGCCGTTGCATTCGAGAGGTCCATTGGTTCCGGACCTCCCGCTATCGCAACCGGAGGCGGTCGCAGCCTTG
GCGCATTCGCATGCAGCTTAGTCTGTCGCAGGCTAAACCCCTCCTGCATTGCAAGAGTAATTGCAGCTTCGAGACTCACGGAAGAGATAGGTCTTCACAG
GCCCATCTCTAAGTCCTTTGATGAACGTGACGACCTTAGTCGCCTCGTCTATCGGGTTGGTCACAATGTTCGCGACCAAATACCGTGCTCTCTGCGCGTA
AGCATGAACATCATGCTTCCCCTGCTGTAGGTCGAGGAACTCTGCCCTCGACCGAAACTCATTTTGCGGGGGCTCAAACGCTTGCCTGAGCTCCTCCTTG
AAACCCTCGTACGTGCTGAAGCACGCAGGATCAGAGAGTCGGCGCCCATACGCCCAACTTCTCGCTCGTCCGCCAAGGCATGCCATGGCGAACGCAACCT
TGGACAACGGGTCGACGATACGTCGAGCCGCGATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGCTCGCCGTCTCTTCCGACATAGTTGCTCAC
GTTTAGCTTCAACGGTTGTCCACGCGGTGTCGTCCCAGACGACACCGTGGTAGACGAAGCAGCATCACGCTGCTCCTTCATGATGAATCCCAGAGCAACA
CCATGTTGCTCTGTCGGTGATAGCGTACGCAGCATCGCAGCTACTACCGCTTCCCCAATGACTGTTGACAATCGTTGGAGTGCCTCCCACTCTGTATCCG
ACAGGTGGAGGCAGTCAGCGCGTGCAACATGAGTTGCAGGCGAAGTGGAGCTTTCCCTGGGTACCTCCGCGCTCGTGAAAAGGTTCTCGGCTCCTCGTTC
GTACAGCTCCGTACGAACGTTCAGGTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAGTGGGCCTACCTTGGCTCACTACTACAGCTTACA
CGTATGCGCACGTGTATGAGGAAGCGTAGG