Description :
From Genome Similarity Track
Location :
scaffold_3:210887- 213176
Transcript NameFunction/comments
Plaha_PHALS_12699ubiquitin-60s ribosomal protein l40
Plaha_PHALS_12700hypothetical protein

Sequence
2289 bases(100 bases per row)
GACAAGATTTATGTTGACTGGCTCGCGTTTTGCAATAGTGTCTTCGAGATTGTTCCGGAGAATTTGGCTCTCTTGTCTACTTGGGGTGGCGGAAGTGCCA
ACGTGTTCTCCAACCGGAACCATCTCTCTCAAATCCTCTTCAAGTTTTTTCTCGGCTTTCCTTAAACGCAAAACTAAATTAGGAACAATGTTTTTTGCTT
CCTCGAGCTCGGATACTTTAGCAAGCCGGACGCGCTCGAGTACTAAAGCAAGCCGGACGCGCTCGGGTAATTCAGCAAACCGAACGCGCCCGAGTACTTC
AGCAAGCCGGACGCGCTCGGGTACTTCAGCAAGCCGGACGCNNNNNNNNNNTGTTCTTCGTCTTCGCGGTGGCATGCAAATTTTTGTCAAGACACTAACG
GGAAAGACGATCACATTAGACGTCGAACCCTCGGACTCTATTGACAATGTGAAGCAGAAGATTCAAGNNNNNNNNNNCTGATTTTTGCTGGAAAGCAGCT
GGAAGATGGCCGCACTCTGAGTGACTACAATATCCAGAAAGAGTCGACATTACACCTTGTGCTTCGTCTTCGTGGAGGAAATTGAGTTAACAGCCGATCA
TCTAGTGCTTCAGTTTGGCTTAAGCCCTAGTCTTTATAGTTAATGATTGCTCATGTTTAAATTCAGCTGTTGTTGCCGACTGTTTTTCAAATTGTGTTTT
ATGTCCTGCTCCTTCTATACATATAATAAGCAGCCAAGAAGTTTCATTTCATTACTGATATGATTGTCAGGTCTGCAATATTGAGTTTCTGGTGTCTTGT
AGAGGTCGGGTCTCGACTCTGGCACTAGACTAAAACCTAAGCTACTGTGTACATTATATAGAGCATAAATTAGAAGATGAGTCGTCAAGTCAGCTTCTGA
TGAAGTTGACAAAAAGCATGGAAGTCAATCACAGCCTTTAACCGCGGAATCGTCTCGATTGCGTCAAGGTTCGCGTCCATATTTTCACTATAATCGTCAA
TAATCTGAAAAGATTTTGCATTTTGAAACATAAACCCCTACAGACAATTCAGCAGTCATTCATGCATTCTATACCTATTCGAATACCGCGGATGGTTGAT
TTCTACCATTGTCATTTGTCGCTCCACTACCAAGATCTGCTAGTTTGTTTTATTATATCTTTTTGCGTAAAATTATAATCGTAAATCAGGCTgaaaataa
taataatattGTGCTTTTATAGGAATGATATCTATGTGTCCACATGAACTGATTTGAAAGGTGATTATTCACAAGGCGATCGACAACAGGATATAGATTC
TTTCTCATTCGAGCGCTGTGTCGTGGAAGTCCAAACGTCAACCGACTGTTGCCACAAGCAGAATATATGAGTTTGTACAGTGCGACACAGGAAATGGTTT
AGTTACGGCAATTGCTAAGGGATCTCAAATATTAAGTGAATTTTGTTACGACAATATATCAAGCGTTGGCAGCGAATCCAGTGTATCACACACGTACCAA
ACATATCGACATCAAGTATCATTACATCCGAGAGAACATAATGCAAAACGAGCTCAGTATTGAGTACAAGCCAACACAAGAAATAGTTGCGGATGCAATG
ACGAAGGCATTACCTCGAACAGAGCATGAAGCGTTTGTCGAAGCTGTCAATTTGAAATCGATACCAAGAATCGAACATGCACATCAAGGGAGTGTTGAAA
GGAGTGATGGTGCATCGTTCTTGCAATTTGTGTGAAGAACATCACTCACGTTTGAACACTCTCATGATTACGTTAATTGATTGCCACTGAATACACATGA
TTGCGGGCAACACGTACACGTGTTTGATATACGATATATGATTGGCTAGTTGGAAAATCTGTTGTGACGagaaggcttagaggtagcgctAGCAAGCTAA
GGACCTTAAACAAACATAAATTTACTTCTCGATATTTCTCCCGACTACTCAAGTCAAGCCCCTCTCCCTGTCACCGCACTCGCAAGGTTGATCCTGGTAG
CAGCCTATAAGTGTTTGTACTTGCCGAACTTGTCCTGAACATCACACAAACAACTCTGAGACTAGGTCTGCGCTTTGATGCCATTGTGCTTATCCCGCTA
GTCCATTGATTGAGGTCAACTTGGTTGTAGTTCTGTGAGCTAAAGCTGCAAAGCCGTAGTAACACTTTAGTGCAGCTCGGTGGATAACAAGAAAAGTCCG
TTAGTATCCGACCAAAGACATAGTTCTTAGGCATTTCAAACACTCCAAACAGCTCACGCGATTCCATCGTCATTTTGTTATTTCTCTCG