Description :
From Genome Similarity Track
Location :
Scaffold_11:210815- 215900
Transcript NameFunction/comments
Phyke_g1535hypothetical protein
Phyke_g1536hypothetical protein PHYSODRAFT_346711

Sequence
5085 bases(100 bases per row)
AGATCCATAGGTCAGCTCGCCGAGGATGAATTTACAAGTATCCGGCCGTTCGATGCCCTCTATAAAGCTGGTCAATACCAGTAGGCAGCCAAAATAGCTC
CCACATGGTCGCTCGATCCATCAAAGCTTGGAGCTCTGGTAAAGTGCAGAGGGCCATTTACATGGCAAACAATCGAGATGGGAGATCTGGGAGATCTGGA
GTTGTCGATCATAGGAACTAACGGGCGGTTCGGTTTAGCTCAGCGTGGCTGAGAAATTTCAGGTGAAATGGTGAAGTGCGGTGGGCTCGACTCACGATAC
CGATTTTGCGCAAGATTAACATGACTAAACTGCAATTACCGCAAGTGCATGCAGCTCGATACGTTCGAGCGATTGACAGCATGTAAGACAGCAACGTACG
CACTTTGGAGGCGCTAACGCTTGGCAACATGCACTCAATCTACCGTACGAACTTGCTGAGCAGTCCGGTGTCTGCGACGGGCTACTTTGAGTTGCACGAC
ACAGTCGTCTCGTTGTGCTAGGCGCCCGTCTACAGCTGTAACAGCAACTTCAGTTTTCAAGCAAGTCGCTTCAGTTCCCGATATTGTAGAGAGAGGAGCC
AAGAAAAAGGCTAAATTTGTTGAGAGCTTCCCTCGGATGGGCGCTCGACTAATTACATGGTCGGTGGTTGTACAGCATTGCAACACAGTATTGGAACGTC
CGCAAAGCCACCGTAGAAGAATGACCGagttgttcttgttgttaTTCCTGGTTTCGTTGAGTAACTTTACCTGCTACCGTATGTCCGCACCGAACATTTT
ATCATCAGATATGTTCGCTCCGTTGACGATTACTGTAAACAAGGATTATGGTCCATTGTGGCCAGGTCACCAAGCTATCCCATTCACGGCAATACGGAGT
TGAGACATCACAACGGTAATGCGTTCGTGCTCCAATTGAGATGCATTTAGAATCACTAAGCTTATCAAGACTTCAGGGTGGCAACATCTGGACGTGTGTC
TGATACGCCGTGATTCCCAGGGTACCCAGGTGTTGACACCAGTTAGCTCTTCATGTAGTTGCTATTGTGGAGACGATAAGGAGGACAAATGGAAACTTCC
TATAGAGGTCTGCCGACtcgttccatcttgtaaGGCAGTAAGGCAATTCCTACTGTAGTGGCGGGATACATGTACTTGACCATGATTATGGAACCAAAAG
GAAAATTACCTTTGTTTTCACGaatgacgagctgcttgacgTTGCTAAGGCTGTGAATGTTAAAATGGGGGTTGTTGGTTTCTGGCCTACTGCGGCATAA
GACGCGGCCCAAGATACACAAGCAGTCAATCCTTCCACGTAGGGCACATCCTCTTGGGTGAGGGATCGGAATACAGTTGCGCCGGAGATCAGCTCTCTCC
CctgccttcagcagcggctTTCAAGGCCATCAGACTAAGAACTGTTAAATACATTTTCCATTgtgccaagatgatgatatcCAATTCAACCCCGCGACGT
TGTCCCCTCGACGACCTTCCTGTTAAGAGGTCACGttcaccagcaacgcctACAGGGACGACctccaagaaacgcaagACAACCCCTGGCGGACGAGCGC
TTGTGCGTTCGGAAGAGTGGTTTAAGCGCCACGTCGCTCAAGATCTGTGGATGCCCCCACATTCTTCGTTATGGCCAGTCATGAAGCCTCGTCATACATC
TCACGCTAGAGAAGGGCTTAGTCTGCACGAATCCCAACGCCCCGAGTCCCAGCGTTTGGTGGAGCCACTACTCACGTCCTGGTTTGACATAACCAACTAC
TCAAGATTTCCCTGAAGGTATACGGCTTTGGAAGAGTTAACCGAAGAGAGACTGATAAACAGAATCATCAAGTTGAGGTTGTACCCGACGTCTTCACAAC
GCGTCAAATTGGAGCAGATGTTCGCCACAAACCGTGCTATCTACAATATACTGGTCGCCCGTTCCAAGGAAGACTGCGCCACACGTTTGATGGTACGGGG
AAAGACACACAAGCTCCAgaagatgacgctgaagGAGCTTGGGAGAAAATATCGCTTTGCATCGCAGACAGGAGAAATGGGACCGTATTCCCGTAACAAA
AAAACTCTGGAGCGTTACCTCCAAGTGAACGACAAGGTTCGAGGCTTTTCATGACTTCACGAAAGTGCTCAAGTCGTCACTTGCACTGTTCTTcgaattg
aagaagaaatacAAGAAAACCACCTTTCCGAAGCAGAAGTTTAAGATCAAATTTGCGCATTCGAACGCGGTTGAGCTCGCATTCATGCAAAGTTGTTCAC
AAAAATGGAAAGGATTATCTGCGGTTCCAACCAACGTTCTTTAGCTTCGGGAAGAGAGATGGTATCGAGCTACGCGAGACGTCACCTGAACTCACGCATT
CTATTCGGCTCCAACGACTACGTGAAGGAGAATATTACGTAGCGATTTCTTGCGTCGTAGAGTGTGAGACCATTCAGACCTCTCGTGTGTACGCCATTGA
CCCTGGGGTCCGAAACTTTGCTATTGTTTACGATTCAGATGGACGGAAGTTGTCCGTCAAGGGTGCGTACATGGTGCTGAAACGGCGATGTGAAGACATC
GATGCAATGAAATTCAAGCTAGCGTTACTGgagaacaagagcaagaacaagggcagagcgaagagcgaagagcaaacagcatcGTAAGCGACATCGTCCT
CGACGATGTATCTGTTTCACGCATCGTCACGTGACTCGGATGATTAACAACATGTATCAGAAGCTCTCAAGCTGGTTGGCTGCCAACTACAACCAAGtac
tgctgccgtcgttcCAGACCGCGGAGATAGTGAGGAAATACGAATAAGTGATGACAGCAGACGGAAAACCGTCGCCTTCACCTGACGAAACCACGGAAGA
GACCACAAGAGAGAATCTGCGTCGCGGGAGAAAGCGTAAGATCCAGTCTTCGACAGTATGATCCATGTTGGTGCAGTCACAtgccaagttcaagacgttg
ctcaagtacaagatggattGTGTCGGTGGACGTGTGGTCGAGTACGAGTACGAGTACACCTCCAAgacctgttccagctgcggtGGAATCAAGAATGatc
ttggaggaagcagcacgtacaagtgttcgttctgccacgtTGTGTACGACCGAGATGCGAACGTGGCCAAGAGCATATTCCACAAGAACGTGCAGATGCC
AGTCTAGAAGTAGTCTCGCatcaatcggtgatgccttcatcgatAGGAGTCCTGTCAGCACTGCTGGCATTATAGGCCCAAGAAACCTCAGTAGCTAAAA
AAGGGTAGCTAGTGCTAGATTTTAATAGgcagtgctgcaactgccTTCTGTTTGCTGATGCCCCATGCTCGTTGCTTCAGAGCATTGATACGGCGACTGC
CACTAAACTGAATTTGCTAGCTTGTTACGCACAGGCTTCTGAGTGTACAGTAGTGGGAACACAAGAGCAGGAATTCGTGTCACTATACTGCGAGCTACCA
TCTAGAGTGAGTCAAGTCATGCACGGATACACTCGTACATGTACGTACTTGCTTACCATCGCTGGAGAAGCCATCCAGTCTCATCACTGGCAGGACGGGC
TACGCGCGGGTGTGTGCACCTCCACTCATTTTTGCGGTGTAGGCTGCACCCTCGGTGCAGGAAAGGGAAGGAAGTGAGACATCTTCGCTGAGATGGGCCC
AAACTTGTCGACGTCGAGACAACCGCTTGGATCCAAGTTTGGTTGGAGGATATCACGACGTCATCACAATGCTTACATCAAGGAATGGCTGGCTGACAAG
GGACGGAGGTCGGCTTCAACGATGACCTGCTTGATCCACATCTTCGGTAGTTCACGACCCCCAAATGACAACCTGCGCGTTGAACTGGCAAAGCCATAGC
CCAACCACTGTGGTGATTACCACAGACTTAAGCGCCATTCATCCAGCGGAGAGTCCGACAGGTCTTTGCTTTAACGAGGTAGGGTGGCTATGTCTTCTAC
TTGCTAACGTACGCTACGTATGCACCAAACGCTCCTATTACTACGCCCCTGGCCGAGGCTAAACGTCACCGAATGTGCATTTCAGGACACGAACCGCAAG
CAGATTGACCAACCGCTCTCTACTCCTTGCTGACTGAATAACTTGACTGCTGTCGGGCCAAATTCGCTGTGCTCCACTTCTTTTTCTCATGTTTTCACga
tttttttcttcgttcGCCAAGGTCATGCGCGAAGGCACGCCTGACAACGTCGATCTCTCTTCCTTAACCACAAGCACATCGTACTCTCCGCTCCCACGCG
CTTGggtttgctcttcttcatcccaTCTCTCCCTCTtattctcctcctcttcaaccACCTCCTCCCTCAAACATGCCCCATAATATTGATAGCGTAGTGT
GTCTTCCTTTGTCAGGCGCTCTAATTGCCAGAGGGCAGCGAGGTCGGACCACTTCCCTGGGCAGCCAAGTCAACGTTCGGGTTACTGTCGATGTGGCCAG
ACATCTCACCGAACATGGGGCCCTGgttcttttccttcttgtgctgcactttgaGGCGCTTGCGGCCAACCTGGAAACCGTTCATGCCCTTGATGGCAGC
ATCTGCGGACGGAGCATTGTCGTAGCTCACGAACCCTGCACAGGAACAGCGACATCAACACAGTTAGATCTGCAGCCACCAAATCCACAACAAGAACCTC
CTCACGTACCAAAACCACGGCTTCTTCCcgtttccttctccaccatgaTGCGAGCGCTAATCACGTTGCCGAACGTAGCGAAGTAATTGAAGAGATCCTG
GTTAGTCATATCGTTCGGGATATGGAACACAAAGAGGTTGCATCCCGGTGGTCCTGCAATACACAACACGCAATGTTTCCAatcacacacacacgtcGTA
GTGTGATGATTTTCAACATTTAGTTCATACATTACATACAAAATGCAAGAATGAAGCaggacaacaacaaggtgTTGCTATATCTTACCTTGGCCACTCT
CCGTGGTCTGGATAGGAGGGCCAGGGCCCACAATCTGCGGCGGGTAACCTGCTCCAACCAAAAAAACACGTTAGCTCCACTTCTC