Description :
From Genome Similarity Track
Location :
Scaffold_236:21079- 22289
Transcript NameFunction/comments
Hyaar_Emoy2813017elicitin

Sequence
1210 bases(100 bases per row)
GGTCAAGTCTGTACTTGATGCGTATGGAGTCGAGATGGGAGGAATCACCTCCACCACAGTCGTGTTCGAAGTGTCTGTCGCCGAAGATGAAGCTGTCGTC
AAGCTGTACGACGTCTGGGCGGAAACAAGCGCGAAATCTGCCATCAAGACGCTCCACAGCGCCAATTGCAGCACCACTGGTCGGTAGGTTACGTTCATCC
TTTCGCGTGGACAGCAACTCGAATTTCCAAAGACCATCCCAGGTTTCGGTGGATGAACAAACAGCGAATGTAGGAATGGGTTGGGGAACAATCGACGAGC
AGTGTGGGAGTAGAATCCAGAACTGGACAGCCACAAGGCAGACGAGAATGCCAGCAGGAAATCGAGCTTGCGATTGCAGTATTTCGTCTACCACCTGCTC
GTTCGAGGCGGTGGAAAAATGCCACCTGTCTACACACGACCAGCCATCTGTCAACTGAAGGTTACCTACGAGGCTTCGCATGTTCTTGTCGAGGAGGATG
AAAGGAGAAGTATTTGATGATTCTCGCAGGACTTCTAGGTTGCTGCTAAGTAATGTTAGAAGTACTTTTAGAGGTCTCTTTGATAGCAACAGGAGGGAGA
CTTTGCTTTGAATGCAGGAGCTCCTTTGCCGGAGAATGTTGCGGCCAGCATATGCGATCAGGTACATGGATGTGATTGATGCTAGTCACCCGTACGTAAA
CAAGTCGTCACGTTGTATGCATGTTCAAGCTCTACATTCCTTTCTGGACTGGAGAAAAGCCCAAAGTGTCTTTGTACTGACAAGGGTTGTCGACTTGTCA
AACGCGACGGCTGCTTGATGTAGAAGACAGCAGGTTTGGCACAGCGTACGTTGTATTCAGCGAATAGAAGCTGTGATTACTCCGTTTCATCGTCTGTAAA
CCTTCTCGTCAACGAGCATTGCGATGCTTCCTACTTTGTAACCACTAGCACACACATCTACGAGTCAAAATAGTCTACTACGACGTAATCTATTATTGTT
GAATAGTCAAACCACCATGCAGGCGCGACAAAGATCGGGTTGACATGCAAGTAGAAGTCGCATATTATACCTACGTATTGCATTGCGAACATTACCATGT
ACAATTTGCACCGCCCAGCTGTACAATACCGTCGCTGTCGATGTAGCTGCTGGTTGCAGCACTGATGATGATTTAGCAACCTAAATTAGTTTGCCTTGCC
CTTTGGCCAT