Description :
From Genome Similarity Track
Location :
Scaffold_1898:2107- 4641
Transcript NameFunction/comments
Phyag_g11704hypothetical protein

Sequence
2534 bases(100 bases per row)
CCGATCGAAGGTGCTTGACCACATCGCAACCCGTGAACTGTACGCGTCGTCTGATAAGCGCGTTCGCCGTGCAGTAATTTCCCTACTCACGCTGTTAATC
TGTATCGAACGCAAACGGCGGAAAGAACCCAACCCGGTAGCAACTTCAGCAGATGAAGTGTCGTCAAGCCCGCCGCTGTCAGGCCGAGGGCCAAACGAAG
ATTCCGAGCGCGACTATCAGCACTACATCGAGCTTCTAGCGCGTGGTGTCGTTAAATGCCTGTTTGGAATCCTTGCAGGTGATGATTTTGGCATGAAGGT
GGATGCATTACGAGCTCTAGCACAGCTCACGCAGGATGCACCTTCACGGCTGACGCTGTGTAAGCCCGCGCTATTGTCTGCGTTGGGGCAGTTCGCCTTC
CATCCGCTCGCTTCCACCCGGCTTCACGTAGCTCAGATCATCGCCAACTTTGCCGAACGTCCGGAAAACGTGTTGAAGCTTGTGGATGCTGGGCTTCTAC
CAGTACTTGTAAGATACGTGAGTCCGCTGGATCGAAGCCATGCAGTTGGCCATGGCAGCGATAAAAACATGAGCGAGGCCTTGATTGTTGAGGCCACCCG
AGCGCTGGCAGCTGTGTCGGAGCTCCATGTCGCTCGCTCGAGGTTAGTGGAGAGTGGTGTGTTAACTACACTCATGCGCTTGACTAGTCGGCCAGATGTG
CGATTTTTCGCCCAAACTGCTGTACGCAATTTACGGCATGACGCAGCGGCATTGCGTATCCAGGCTATCTATCGAGGCTGGCACGTCCGTACCACGTTCA
GTGGTGCGAAACGCACACAAAACTTCCGCAAACTTTCAAGGTTGGTAGAAGCTGCGTCAGCACCGATCAAACAACGTTAGAACTTTTCATCAGCATCCAT
ACTGCTACAATGATCCATTCCCCTTTTCTTAACAAGAACCCGGGCCGAGCCACTGGGGACAGTGTAGTGGGATCCGAATGAACACACTCACGAGGGAAGC
TGGCGCTTCCTTAGAACTCTTGCTTGTATTGTAGTCTGCAAATTCCAGAATGAGAGATCGGTGGGCCTCTCATCAGATACTCCCACATTGCTGTCAGGGT
ATCTGCCACTAGCTTACCAACCTCCTAGTCTTATTCTACGCCAGCTTTAACTGCGACCTTCCTCGGCCGTCAGCGCAGTGCGTGGTCAGGTCATGAAGAC
CGTCGCCCCACTACACCGCCCTACCAAGACTTGACCACGCGTTTTGAAGCCTTGCTTTGGATGTTGCTCGAATGTAATATGAAGTCCAAATGTGTACCAA
ATTTCGGGTACAGGGGTACGTGTTCGCTTtgctcttcaacttgaagtgctAAAGTTGCTCCAAAGTTGCACTTAGCGCGGTGTCATTCTCCCCAACTATG
TACTGCTTCACCATCACCGGGATGTCTTTGTAGagcgacttgagcgactCCCAAGAGTCCTCAATTGGCTCCAGACCTTTCCATTCAACCAGTATCTCGT
AGCACCTCTTTGCCGGGTTCCACCGATGATCTTTGAGATCTGCAACTGCAAGGACAATCTCCTGAGCAGCCATGTGCTCACGAATTTCTTCCGTCACCTC
AAATGACTCATCTGCGTAGAGCTTTAAACGCGAAGCGTGCACGTCTGATTCCGCGCCAGTCACCAAGTGCTGCACGCGAAATGAGTGTTCGTCTGCTCCT
GTCACCTGATACGGGCCAATCCATGTGACCAATAGCTTGTAATTGTGTTTTTGGTCCACCCTCGAACGTAGAACGTAATCACCAATATCAAAGCTCACCT
CCCTGGCCCCTCTTTGCATGTTCTGATTTCGTTTTGTTTGTTCCGCCCTTGCTGTCTGTACCTTCTTGTGCATCTCTTGCACTCTCGTGCGCAACATGCA
CAGCTTCTTGTCAAGCTAGTCCGATGTCACGTCGGTGCTGACAAAAGAGTCTGCCTCGCTGTCGAACCCGAAGTCGAGAGGGGACGTAGCAGGCAGGACG
CAAAACAATTCCACTGGTGCCTTGTTGTCAAGTGACGGGACAGATGTGTGATTGAGACTAGACTGGAGAACCGGAACGAAATGGCTCCAATCTCGAATGT
CCATCTTACCTTCGAGGCATATAGCGCGTAGGACTTGAATAATATCCCTGTTCAATCTTTCGATCGGACCGTTTATCCACGGGCTATAAGTCACCGTGAA
GCGCTGATGACTGTCTAGACGCTTCGCCACTTCGGCCACCACTCGGTTTTTAAAATTGTGACGGGCCACATCCAAAgttacatttgtaggtagagTTACA
TAATTTGATACAGAAAGTAGGTACAAGCACGCGGGTAGCGCGTGCTGTATTGTCACTctccgattggctgaaaagagtcAGTATTTCAGCCAACCCAGAG
TTGACTCGTAGATGAGTGGTCAGGGCCACCTGTCCTGGACCTAACACCAAATTAGAGTTGAATTTACACCCAAACACATACTTGGACCCATTGTTGCAAG
CTTCCTCTTATCTATAGTGTACGCCAGTAACGGT