Description :
From Genome Similarity Track
Location :
Scaffold_212:2107- 3448
Transcript NameFunction/comments
Phyta_totarag5667hypothetical protein

Sequence
1341 bases(100 bases per row)
ACTTGGACCACAACATGAATGCACTGCGAATCAACAAGGTCAGTGCAAGGATGACTAAGTTTCTCTACACCTTGAGGGCCACTACAGCCCTTCAGAGAGA
TTCCCATTATGTCAAATTCATCACTCCTTCTCGCTTCGCAGCACACGCATACCTGACCAGACACACACTACATGAAGATATTCACACTCTAACTACTTTG
ATCGTTGAGAATCAGATAGGAGCGAAAGACTTTGATGGAATGTTCTCAACAGCAGCCTTGGGGGCGTTCAGTTGAACTATGCATTATTGAATCATCACCT
CCTCAACAGACACACAATACATCAGCACTAGGCAAGCTCAGTTGGAAGGCAGCAGAAAGTGATTTTGTTTTCAGCGGCAACACGATGATCGCCTCAAACA
AACACAGATATCCTTTCTTTCATCAACGCTCACACTCACAAACACACAAACCGATACACAAATGCACAATTGAAGTACGGACTCAGGCAGTATGAATACA
ATGGCAGTCCACACGGAGCAATTGCTTCTCGGAAGGTGTCCTAAGTTTGATTGTCATCCTCATCCGCACGCACAACCCAACAtacaaatacatgtatata
caTACATACAGATACACATACCACTTACATGCACAACATACATTCACGATCGGATCGATCAAACTAGCACCAATGTCCTGGCAAAAGAACGTCGGGTCTT
TCGGCTGTACTCAGCGTCGGTCGTATGGGGAAAGAAGTTTGTCCTATCATCTCGATCACGTGGGGGGAAACCTCGAAGAAATGGGAAAAACTGAAGctgg
atggagctggtggGCGGAAAATCGGCAATGAGGAGTTAGTGTGGGCGGCGAGGGTGAAGCTGCCAATTGATTTAGCAAACCTCCACAGCCAGTCGTTGCT
GAAGGTGTCATTTAAGTACGAGTTAGGTACGGTACGATCCGAATTATTCTGTCTCTCGCGGTAGGCTGAGTGCATAATAGGGTGAAATATGTAACGTGTG
ACGGAATGGCTACAGTACACGTTGATAAAATCTCAAGCACTCGGAGACGTAAGTTGGGAGCTAAGCTTACGCCAAATGTGCAAGTGGGCACACATCTCCA
GTATTATACGAGCAATCGCTTTTGCATGGGTGGCGATGTGGCGGACACGATGGTAGCATCTTCCCTGTTGTTTGTTTCTCGAACTGCTCGGGTACTGGGC
AGTGCACCAGGAGTGGAGATCATTGTTGGTACGACATCACGCTGGGTAAAGGTCATCTTCAAGATAAATACCAAGGTGGGCAACGTATCTGTGTGGGCGG
TTTGTGgggtgttggtgctgctgacagcCTCGGTCCTCGTA