Description :
From Genome Similarity Track
Location :
Scaffold_283:21065- 25637
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_283-fgenesh-gene-0.9Aspartyl protease family A01B
Pytve_DAOMBR484maker-pve_contig_283-fgenesh-gene-0.10Aspartyl protease family A01B

Sequence
4572 bases(100 bases per row)
CCTCTCGAGGTCTTCGTCGTCGCTATCACCTATTACGAACTTGGGCGACGGGGCTTTCCGAGCAGCGTTCTGTCGAGGAGGAGACAGTACCCGAGATGGT
CGCGGGGCTTCGTCGTCCACCTCTTCGCGTCGACTCGGCGACGTTGGCGTCGTTGTCGCTGATCGAACCCCTCTCGAAGACTCAACATCAGGGATGGCAG
CCCACGAGCGCTTCCGTCGCCGCGTCCACAGCACGACACCGACGGCAATGCCGAGCAGTGTGATGATCAACACCTCAGCGATAAATGTGCCCATTGCTGG
GCTCGAGCGCCGTTCGCTGGTAGCGACGCTACCAGTCGAGTCAAAGCTGGTTGCAGCATTGCTGAGTCCAGTTGGCGAGGTAATGTCGCTTCCGCTTCCG
CTTCCGCTTCCGCTGGAGATCGTGGCGTTCTTCCACGATGCAGCTCCTTTGCCTGTCGACAGCATTATCCAGTGAGCGTTTTGTAGACGAGTGGATCAGA
GCATGTAGTAACCTACCGCAGAGCGACTCGGCAAATCCAATGCGCTCGTTCTCCGAGTCAAAGATGACGTCCAGTCCGACCATCGAGCTCGCGCCAAGCA
CTAAACAGAACGAGGATACAAAACACGTTAGAGTCGCTTCAAGAATGTGCAAGCAGTCGATGACATACCTCCGCCCGTGCGCTCCGAGAAATGAAAGTTG
CCGTAGTAGTACTTCCCGTTGTCGGACGGCGTCAGGTATTTCTCCGCAGGGATCTCGAGCTCAATGTCGCCGTCTGAGCTGCCTGGCATGCCCGCGAGCA
CGACCGTGATAGTCGGCAGCTCGGCCAGTTCCTCAGCTGTCACCATCATCTTGGTCTCGCTGTACTTCCGCCCTGCTGCGGCCTCGAACAATTGCTGGAA
GCTGCGAGAAGCGCTCGACACAAAGAACGTGTCGGTCGTGCCGCTGTCGACGATGACTCCCTTGCCAGTATTCAGTTGGTCCTCTGGGACACCGAGCGTC
GTGCCGCCCACGCGGATATCCTTGAGTCGGACAGGGTAGAACGACGATTTGGACGGCAGCAGCGGTGTGTACGCCACGTCAGTCGTGTGGTGGCTGTAGT
CGACGCCGCCGAGCACCATCTCGCCGCCACTATGGTCGAAACAGAGCGAGAAAATGTCGTGCTCCAAGCGACCAGCGCTGAGCATGTGCGCCATGACGGT
CTTGGAATGGCGTCCCATCCCCATAATGCCGTTCTCCTTTTGCGTGATGAAGAGACCCGTCTCCTTGGTCTGGCAGCCCAAAGGGAAGCGCACGCCGTAG
TGCTTGACGATCGCGTCTGCGTCTTCGCCCGAGAAGCCGCCGACCCAGACGAGCTCGTCCACGACGACCGCCTGCCACATGCTGCCTTCCGTGTAGCTCT
GCAGCACACCCACCCGTCAGCTGCCTGCCATCTGCATCGAAGTAGAAATGAACAGGAAAACCCCACCTGGCTAATGTAGCACCGGTCCTCCTGGCATGAG
TTGCAGCTCCCGAACGCCTGGCAGGCCAAGTACCGCGCCGTCGTAGACTTGGACACGTCGAACAGCGGGTCCGTGTGCTGTCCGCAGTCCATGCATCTGC
AGCCAAACACCGTCAGCTCAGGCTCTCCATTCACCATCGGCAATGCCAATACTCCGTACGTGCTGCAGGGAAGCGCCGTCAGGTGGCTGCCCGTGTCGAC
GATGACCGACGCGCGCTGCGCTGGGACGCCCATGTAGATCTCGGCGTAGTGCGTCCTGCGTTTCACACCACCACAAGATTACGCCAAACGCCTCCAACCC
TCCAAGCTCCAGCTGCTCGCACCCGTAGCCGACGCCCAGCGGAGCCTCGCTGAATGCGAGCGCACCCTGCACGAGGTGGTCGGCGCTGTCGTTGCTGGTC
GCCGCCGGCAGCTCCTGCGCGCGACGCCGCACACGCTCCCGCTCGTGCGCGAGCCGCTTCTCGGCCGCCACCGCGTGCTGCCGCTTGTGCAGCGGGATGC
GCATGATGCCGCCCTCTTGGAGGCTGCGCGGCGCGGACGCGGGACGAACAGGGGACGCGGCCATCTTGGTCAGCAGCACGTGGTGAGCTTGTCGACTGCC
GAGCTGAGCAGAGCAGAGCAGCGCGGCCGAGATAAAGTCGGTTCGCGATTGGGCTCGTATCCCCCAAAATAGCATTCGAACATTTTATATATAACCCTAT
CCTCGATTGTGATAACCGATGTAGATTGGCTGAATATGAGATGTGGTGGGATGTGATTGGAAGGTAAATCGGTCAAACAGCCACCAAAAACTGAATTCAT
TTTGAGAGAGCCGTAAACTTGCTTCTGCACTTGACCTGGTTGCAGTATCCGCCATCAAAGAGGCGCGGATTGACCTCACAACGGCCACGACGTCGATATT
CAAAACGAGTACACTCGAACGAACAAAGCGAGTCCCACGCAATGTTAGAGCTGCTCTAGCGTGCGCGAGTCGTGCTTGGTCTCGTGCGCCTCGTTCTTGA
AGACCTCGTCGTCGTCGTCGCTGTCGCTGTCGCTGTCGTCGTCGTCGTCGTCGTCGTCCGCCGAGTCGGACAGCGGCTGGTGCTTCGCCTTGCTCGACTT
GGAGCGGTGCGGCTGCGCCTCAGCTTCGACCAGCCCGAGCTCGTCGTCGTCGTCGTCCTCTTCGTTGACGCGACTCCAGTTCTGCGCCTTCTTCTTGCGG
TTCTTCTTGTGCCGCACGGACGCCACAAAGATGACCAGGAACGCGACGGCCAGCACCGTGCCCACCACCGTCAAGACCATCGGGTGGTTTTCTGCGCCTT
GTGATCCGCTGCCGCCGTTCTGTTGCGTCGTAGCGTCCAAGGTCGCATTCGATGCACTCGATGTCGGTGCTGGTGTTGACTCAGTCGGCGCGGTGGTTGT
AGCAACGTCTGCAGCTTCGGTCGATGCAGGAGCAGTCGTTTCCACGCTCGGACTGGAGTTGGCAGCCTTGTTGGTTGTTTGTGGCGCTTGTGTTGGCGAT
GCAGTCGTCGACGGGGCCGGTGTCTCGGTTGATTCATCCGTCTCTGAAGACTCAATTGTCGTCGGGGCCGGAGTTGGAGCCGCCGTTGCTGACTTGGGAA
CAGTATCCTTCTTGGGTTTCTTCTTCTTGCCACTTGTGCTAGGCGAAGAAGAAACGTACGCATCCGTCCCGGAAGTGTACGAGCAGTCCGCGTCGACGAA
CCCCACGCGCTGACTGCCGCCGTCGAAGATGACGTCGCGGTTCGTCATGAGGTTGGCACCGATGACGCCACCCGAGTACTCGGACAAGAACACGCCGCCG
CAAAAGCTGTTGTCGCCCTGCAGCAGGTACTGCGACGGCGACACTTCGAGCGTCATGTTGCCGCCGTCGTCCGACTCGAGCACAAACTGGATGTTGGGGA
GCTGATCGGCCTGCTCATCTGTGTAGCCCTTGCAAATGCCGCTCGAGGGGTGGTACGCGAGCCCTGCGACAGCCTCGAACGTGTTCATGAACTGGTCCTT
GAGAGCGCGTGGCAGGTACGAGTCGGTCGTGCCGCTGTCCACAATGAATCGCCCGCGATTGTATGCCGCCGGGTCAGCCTCGATCGACTTGCCGCCGATC
CGAATGTCCAGGATGTGGACATTGTAGAAATTGCTGTCGACACGCACCAATCAATCAGCACTTGCCGCAGAACAAATACAAGCAGCACAGCGTACCCGGA
CGAACGATCGCCAATGACCTTGGCATACTGGATCTCGCCTCGGTGGCGCTGCGTGTCGGGCTCACCGACCGTCATGGACCCCCCGTCCTCGCCGAAGCAG
AGCGCGAAGAGCTTGCTGGGGATCTTGTTCTCCTGGTGGAGCTTGGCGACGAGGTGGTTGTCCGTGTTGGACAACCCCATGATGCCGTCGGCGACCTGCT
CGATGAACAGACCCGTCTCCTTGTGCTGGCAGCCGAACTTGAAGTGCGTGCCGAAGCGGTTGCGCGCGTCCTCGTTCTCGAAGCTCGAGTCGCCGCCCAG
AAACACAATGTCCTCCACAACGGTCGCGTCCCAGCTGCTGCCTTCCATGTACGACTGCGAGATGGCGCACGTGTCCGTCTCGAGCTCACAGCTCCGGCAG
TTGAACCAGTCCTTGGCCGCGCACGTCACGTGCACGAGCGTCGCCGAGTCGGACGCGTTGAACGGCCTGTCCGTGTGGTCTCCGCAGTTGTCGCACCTGG
TCGTGGCGGTCAAATATCCGTCAGCATCTAGGTGTATTCAAGCAAAACTGAACTTTGGCAGCCTGCACTCACCCCGTGCACGGGAAGGCAAGGATGCCGC
TGCCAGTGTCCACGATCACCGACGCGCGCTGCGGCGGCGTGCCCGCGTACACCCACGTGTAGTGCGTGCTATATTCACACACATACATACAAAGAACTGT
CAGTAGCTGCTCGAGCAAAGCACAAACCCATCCACAAGATCGAACCCGAGGCCAATGTGGAGCGGGATGCCTTCCAGCGCGCTCGAGTCCTCGCCGTCGT
CCGTCAGGCGGCGGCGCGCGTACGTCTCAGGGTGGATACCCTGGTCCGGAAGCCGGTGCAGCTGCAGCACCA