Description :
From Genome Similarity Track
Location :
contig_54:21063- 24307
Transcript NameFunction/comments
g11225.t1hypothetical protein
g11226.t1OWZ07258.1 putative membrane protein [Phytophthora megakarya

Sequence
3244 bases(100 bases per row)
CGCGGCAGTGGCCACTGTCGCGTGACGCAATACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGT
CGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCTCAGCCTTGCTCATTGAAGCGTTCCTTCTTCGATTT
CGCGCTGAGGGCGTCCGCGCCCTCAGCGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATG
CGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATCCAGCCTCATCTTCT
TGTATTGGAGACCAATACTCGTACGCGTCAAAACACTCAGTGTCTCGGCGGTTGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTC
GGTCCCTGACCGAGACTTGCGCAGCTTTTCTTGCTTGCGCCGTTCACTTCTCGTTCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTG
GACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGACCGGCTTGATCGCGCATCACTTCGTCGTGCAGCCCGGCTGCAC
GCGAGCTCGCAAGCATTTCCGGTGAGGAACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGCCATCTTTACCTCTACGCCT
AACGGCGGAGTGTCTTTCGACAAATTGTGTGCCGACATTATCTGTCGACACGACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCCGATTGAATC
AGGCCCTGCTGATTCGTTTCACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTCGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTG
GTGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTT
CGTCCAGTCGATCACCGGATCATGTCGTGCAAGCCGCGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTTGAGGACGATAAGCTCGTCGACGAAC
TCCTTCTCTTGATACGAGAAGCGTACGCGGACGATACGCTCCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTT
TCACCTCCTCGAAGGCAAGCCTTGGAAGGCTCTGCAGTCGAGCAAAGTTGTTCGACGCACCACAGTCCACTAGTTTAGCTAGGTTCTGCGTAGCTAACAG
AACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCGTTCAGCCTTTGCCGATCGACAGAAGCTGCTGTTGCGTCCTGGACA
AACCGAATTACAGCTTGTCGGCGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCG
CGTGTTGTTCGTTGTCGTTTGAAGTGTCGTAGACACTGTTTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTT
GTATCAGCGTGCTTATACGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCC
TCAAGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGGTGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAG
CGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGC
GTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGAGAGTACTCGGATACTCTCGGAAGAGATAGGCCT
TCACAGGCCCATCTCTAAGGCCTTTCATGAACGTGACGACCATTGTCGCCTCGTCAATCGTGTTGGTCACGATGTTCGAGGCCAAGTACCGTGCCCCTTG
GGCGTAAGTATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCTCTTGATCGGAACTCGTTCTGCGGGGGCTCAAACGCAAGTTTGAGCTTC
TCCTTGAACTCTTCGTACGTGCTGAAGCACGTAGGGTCCGTGAGTCGGCGTCCATACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACG
CAACCTTCGACAACGGGTCGACGTATCGTCGACCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCCCCCTCTCTTCCAACGTAGCT
GCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGA
GCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCT
GGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCC
CGCGTTCGTATTCCATACGAACGTGTTAGTCAGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTAC
ACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTTAGTATACTTGTATCCGCAAGTATACTGAAACCTAGATAAAGGAACCGAACG
ATAGCTTTGATGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGTTGGCAG
AACCCCTACCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGAGTGGTCA
CCTGAATGTATCCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG