Description :
From Genome Similarity Track
Location :
Scaffold_243:2106- 3415
Transcript NameFunction/comments
Physo_144684reverse transcriptase

Sequence
1309 bases(100 bases per row)
CGACGGCGTTCTTCTTTATGATCACGACAATGGGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTCCCGCGTGTTTATTCGGGTCAAACCACTGACGCAATTGGTTGAAGAACTCCTCCATCGGGC
ATTCTCCGGCTTCGTGCACGTCACCGCAGGCCTTGCACACCCTCAAGCATCGCTCCGTCGGGTGTTGGCCACCACACTTCTGACACGTCAACAACTTTCA
GCACATAGCGACGTGAACCACAGTGGCGGCACCGCGGGCGGTCGCGTCCCGAGTCGTCGGGATCGAAGTTGCGACGCGCCGGCTCTCCCGGCGGGGCCTG
TCCCGCGACGAACAACTTGGCGCGTTCTTCGTCCTCCCCGTCTTGATCGTACTGGCGATCGTCGCTGTCGCGACTCTCGCGTTCCGAGTCGTACTCGTCC
GACGCAACGTGAATCGCATGCACGGCGCGCGCCGGCTGAGTCGGCGGGGTCGGAGCCTTTTGGCGGAACTTGTTCGAGCCGAAGAGAGTCTTCTTCTGGT
GAGCCAATCCACGTTGTCGGGCACGCAGCTTCTTCTCCAGCGCCTCGGAGTCGGCGACCTCCATCAGCGTGAGACGCGAGGCGAGTTCGGCCTCCTGCGT
GTTCAGCGTCCGGATGAAATGCTCGACGTGTTCGCGCTTCTCTTCAGTCGTGCCCTCGGCGTATGGGATGTTGGCCCTCAAGCCCGCCACGTTGAGCCGG
TACAAGTAATCCAGAGGGGTCTTGTCGGGGCGCTGAGCCGCATGGTAGTAGCGACTGGCCATTGACACGCCCTTGGCGCAGTACTGCACCCGGAATTGCT
CCATCAGCCCGGTCCATGATTTCTTGACCTTCCTGGGCAACTGGAGGTACCATTGGCGCGCAGGGCCGCTCATCAGATCGCTGAACTGCCCGCACACTTC
TTCACCCGTCATCCCGGCGCGCCGCGCGGCGGACTTCAGACGGTTGAGCCACAGTCTGGCTTTCTCTTCGCTGGCGTCCCGTCCTGAGAACTCTTTCAGC
TCAGACGCTGCTGAGAAGCGTACGCGGGCAAGGCCTACGCCGCCGGCTGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCACAGAT