Description :
From Genome Similarity Track
Location :
Scaffold_170:21059- 22942
Transcript NameFunction/comments
Phymu_g5980hypothetical protein PHYSODRAFT_539377

Sequence
1883 bases(100 bases per row)
GTACATTGAGGCCCCCGAGCGGCTCGTCAAGTCGGAGAAATCGTTCGACAAGTCTGCCGTCATGCTCATTGTGTGCGTGAAACCTTCGGAATCGCGAACT
TTACCAGCCTCGGGGGCTTCGTCCGAGATACCAAAGTAGTACAAGTCCCAGAGCTGTTTGTCCATCAATTGCTCCTGTTCCCCGCCAGGACGCAGGCCAA
ACGACGTCGACGGCTTTGGAGCTAGAGGAGGACCCCTAAAAGCCTTCGATTTCGGCGGGGTACCTTCTCCTTGAGTCGGAATGTACATGGTGACGCCGCC
ACTTCTGGAAACGATCACTTTACTAGTTTCCTCGTCCTGTTGGGGGACCTCGTCCCGTTGATCGAGCCACGGCACGGCGCGACAGGCCTCGACAAGCTCG
TGAGGCTCGAAACGAGCCGAACGCTGGCGTGCGCGCGCCGCGTTGGACTGCGTCGgctcatcgtcgtcgttttcttgcagcgtctgcgcgcCGGAGCTTC
TGATGCTCATGAGCTCGCAACTTTCGCGCGGCGGAACGGGCACGAACTCGAGCGAGATCTGCAGTAAACCGGCGTCGTTTCCTGCCAGCGGTAACCAATG
CGGACTCAGACGGATCACCTTGCCACTGCCGTCGGACGCGTCTTCCTCGAACGCGCGCGCCTTGGAGGAAAGCAGAAGATCTTCTAGTGCGACACTAGCG
GACGCGACAGTGCGTGCGCCGCACACCACGTCGATCTCGAGCTTGCACTCACTGGCTTCTACGCCCACGCCGGCCGCGTCGCCCGCCGTTTCTTCCGGTT
GACCCAAAGCCCAGGCGAAGTGGCCCCCCATTCCGTCGCGGGTGCCGTCTCGCGCCGTTCGCCACACCGGGTTGCTCTTGTTCCCCGAGATGTTGCACGG
CGACTGCTGCACTGCACCGAGCAGCGTGCACCTCACACTGAGCTTGTGCTCGTCGTACAATGCGTCGGTCATAGGCCATGGAGCGGACAGTTGACGGGCT
TCGTACACCCACACGTGCAGTTCTCCTTCCGGCACGCTGTCACTCAACCGATCCACCGGCTCGTCCGCCGTTGAGGCGACCATGACCGGCTCCTGGGGTG
TCGCGCACGACGTGCGATTGCTCTCGAGTATGGGcaggtcgtcgtcctcgtaTATTGACgcggcttcatcttctttcGATGCGGTGTTGGTCTGTTCCCG
GAGCCTGAACATGGCCGCCATCTCGTTCACCAGCGGGTTCTTGGGACTCAGAGCGAGGCCGTGCACGTCGCCACGGGCCCATTCAGTCTCAACTTTCACG
TCGCCGGCCGACTGCGCCTTAGCGTCCGGCGGACGGTTGGCTTCGGCGAGGGTCggctcctcgtcgttgttgcTCACGAGCATGTGGTGTCCACGCAGCA
AAGTCGGTAGTGAGCCATTGCGGCGGCCTCGTTTTCCGGAAGTTACTTCTGCGAAGAATGAGAGGAAGAATAGCGAGGCCCGTCGTTTCGGCCGCCACGA
CGGACTAGCTAATATACAGGCTGGGGGTTCTGATATCGAGGAGGAGACTGAAGCAAAAGTATCCCGTCGCTGGGCTGTCTGGGCGGTTTTCAAGAGAGTG
CGTGCCAGAGAACCGCAGAGACAaaacgctgcagcgtttTGTTTAGCCTAAGGACGAGCAGAGGGGCAAGCATAACGTCCGCCTTCGCATGGGGCCCTGG
TAGTCCCAGTGGTACGGGGCCGATACTTTCCCGCGGGGTATTATCTTTCGCTCGCGACAGAGCGAGTTGCGGTGGCGTGAGCCGCTCTCTGATCGCTTGT
TGTTCGAAGTATCTTTCCAGCGTTAGCGATAGCCGGAGCTTGACCGCTGTTGATTTGCAGTGGTACAAGGTGTGACTCAAGCG