Description :
From Genome Similarity Track
Location :
Scaffold_40:21058- 22597
Transcript NameFunction/comments
Physo_135670Os01g0592900

Sequence
1539 bases(100 bases per row)
GCCTTACGAGGTAGGACCGCATCGGGAGACTTCAGCAGTAGTACCTTTCCTCGACACACAGCAAAGAAAACTGCCCCTTTGGGATTGTCTGTGATAGCTT
GATGATATTCATCAACCACTGCTTTAAAATCCGCTCGACCCCGTGGCTCCACAAATGTTTGCTTCTGCTGTACGATGCGATCCCATATCGATAGAGCCGA
TTCACCCGCGGCAGGCCGCTTCCACTTATCGATACTCTCTTCCAAAATGGAGTAGGAAGGAAAGAACACCAGCAAACCATGAGGGACAAGACGCGTAAAA
TTCACGATTGTGTTCCCCAGTTCCAGCAAATACGTTTCAGTCGACCGGAAGTTGTAGCTTGAATTCAATCGTTTGCCAGTCACACCAGTGCCCACCACAC
CCACCCAAACTTGATCGGCATCAACAACGTGATTGTTTTCTAGGCGAACTGGGAAGTCAATTCCAAGTTCTTTGACCGTCGTATCCAGCGGTGAAAGAGT
TCCACTTCAAGCACATCCACGGCACGCAGTTAGGTACCAGCATCAAAGAAACCACTAGTATATGACCTTACCTCGTTAGGATGACATTGTGGACGTTGTT
GGCGCAGATTTCACGAAAAGCGACTCCAGGATGGAAGCACCAATAGTTGAAGACACGGGTGGTCGTCTTTTTGTTCCGACCACCATTAAATAGGCGACCT
GCGTTTGAAGGTCTGCATTAAAAAGTACCTCAATGAAGTTAGTAGATGCGCTAGCGGTCGTGTAAAATGGATAGTTGATATACCTTTCTCGAACTTCTTG
GATGTGAACTCTATAGTTTTTTGCTGCCTGCAAACAAAAGTGATTGTTAAGAGATTTCACAAACGAGCCCAGGAAGGTCCAAGTACTTGGAACGGTTGGT
TACCTGTAGATGTTGCTCTTTGCTTCGAAAGATTGTACCCAAAAATGATAGCATCGTATCGAGCTTAGATGCAGCACGTTGTGAATCGTCCCCGCCATGC
GCCACTTCTATGATTTCTTCGATCATGTTGAGAACAAGTGGACACGTCTCGAAGTTCACGTTAAACTGCTCGAAGAATTCAAAGATATACTGCCCCGGCT
GCAATGCAAATGGCAAATGTATGATGTCAGCGAATCGAACGCATTCAAAATGAATCCCATTCCAAAATTTCCTTACCTTGGTAAACCCTCCACTCGAAGA
TAGCGGGAATCCGTTGAGACCCTTGTTAATCTCCATGAAGAGAGCTCGAAGCGTTTGAGTAGACTACGCACGGACAACATTAGCAGTTTATCATGCATAG
GGAGTGGATATACATCAAGTACGCACCTCCATCGTTAGGTTGCTGCCTGCTTGCAGTTGAACGCTATTATTTTGGAGAGCCCTGATGAAGGTGTCAACTT
CAGAAATGCACCCAGAAATGTCATTCGATGAGAGCGCGTAAGAAGCTGCTTCACTAGCTATCGATTCCTGTAACACCAGCAAACACGCAATTAGCAACAA
CCCAAACATTACCCGCAGGCCACCAACGCATACGTACCA