Description :
From Genome Similarity Track
Location :
Scaffold_8:2105641- 2109845
Sequence
4204 bases(100 bases per row)
GATGAGCAAGTCTGCTACCACGTGAGTGGGGATCTGCACGCGGAAGATGTTGAAGCGGAGATGGCGGTGCTACCGGAAGTCATTGCGACCACAGACGAGG
TGACTATTGAAGACATCCAGGTGGGAGATCCAGAGGTTAATACGGCGGAAGAAATCGATCGACTCCGGCGGCGGATCTGGAGGCGCCGGCACCTGCTGAT
TGGTAAAGGCAACGCACTGCCGCCCGCGGCACGAGGAGTTGTGTGCGACAGTGATGTGGGTGATGCAAAGCCCATTGCTCAGCGGGTGCGCAAGGTAGCC
CCGAAGTACCATGAGAAACTGTCGGATCTAATCAAGGGGTTGCTCGGCGCCAAGATCATCAAGGATTCGACTTCACCGTGGGCATCTCCAATTGTGGTGA
TCATCAAGAAGAATGGGGTAGACATACGATTATGTATCGATTACCGGCTGGTTAACAGTTTGACCCGGCTGATGGTCTACCCGATGCCCCTAATTAACGA
CCTGCTTGAGGATCTGGACAAGGTGCTTTGATACTGCTCTTTGGATATGACAGTGGATTCTGGGTGGTGACGATGACGGATCGGGCTCGTGCGATCTCCG
CCTTCATCACCCCCTTCGGGCTGTACGAGTGGAACCGGATGCCTTTTGGGTTGAAGAATGCACCCCAGGTCTATCAACGTATGCTGGACAACGCGCTGTA
TGGATTCACTCGGATCCCGCGGCTAGAAGATGGATCTGGATCGGAGCGCGAACCTAAATCCAAGCGTGGATCTGTATCGGAGGTGCTGAATCTGGATCTG
AAGTTGGGAGAACCAGAAGGTCCAGGCAAACCATCCGTGCTTGGACGACGGCCGTACATTGACGACATATTGATAACTGGTGGAATCTGGGACCATCTGT
GTGAGCGTGTGGACGCGCTACTGGACGCGTGCGATAAGTGGAATCTCTCAATCAGCGTGGTGAAGAGCTTCTGGGGCAAGAGTATGGTGGAGTACCTCGG
TCATCGCGTGTCAAATACTGGACTAGAGGCGAATCCCAAGGATCTCTCGGCACTAACGGAATACCCTTTCCAGGTACACTTAGATCCATGCAGTCGTTCC
TGGGCAGTTTGAATTACTACAGTCGGTTTCTGGAGGAGTACGCGATCTACGCTGCGGTTCTCTACGAATTACGTGAAGTGGACTATGCCGCGATGAGCAA
GCCTGAAAATCGAGGCCGGATCCAAGCGGTGATGCCTTCGACGACTCCAGATCCAACGGAGCAGACCTCGTCCGACATGGCGGATCTAGACCTACCGGAT
ACAGACTCTGGATCCACGAAGGCTGGGAAGCGGAAGACTTTGGATCTGGAGGCGAGTGATCCAAACAATGTAGATCCACGTTGGATTCGCGCTCATCGGG
CATTTGCCAAATTGAAGGAAAAGGTGGCAATGATTCCGATCCTCCGACACTTCGACTCGGATCTGTTGCCGGTGGTGGTCGTGTACGCTAGCGAGTGGGC
GATCTCAGCTGCCCTGATGCAGGAGCACGACGGGGTTCACTATCCAGTGACGTTCACCAGCCGCACCCTGAAGTCCAACGAACTCAATTATGGCGTGGTG
GGGAAGGAGGTGTTGGCTCTGTTGCGGATCCTGGATCTGGATTGGTTGGACGCCCGATCCGAGTCTTGACTAGACATTCGACATTGGCCTGGTTGTTCAG
ATCCACGGGCCTGCAAGGGCGATTGGGACAGTGGGCGGCTCTGCTCTCGCCGTGGACACTCGAGATTATGAAATGCACGAAGGGCGAAGATGAGATCCTG
GGGACTCTGGCGGCCAGCATTACACCTAGATCCAAGGTGGATCAGGCTTTGATCGAGATTGCGTCCAAGAAGGAGCCACGACGCAAGATCCAGGCACCAA
TCCCGACTGTCCGGCCTGGTGAAGAACTGCATGTGGTCAGTTTCGATGGATCTGCCCGTGTCAAACGTGGTGGAGGCGCATACAGCGCGATCCTGTGGAA
GTTACCGGAATGGACTGTGGTGAAGGCTAGATCCGGCTATGCCGAGGGGCTGACCGTTAATGAGGCGGAGTACCATGGACTTCTTCTATGCTTGGATCTA
CTCGAAGGCGAGGCACGACGACGATTGGTGATCTGTGGAGACTCCAATTTGGTAGTTCGCCAAGTCCGAGGCGAGATCGACTGCAAGGCACCGGGATTAA
CCCTTCTGAGACAGAAGGCCCTGTATCGGCTGCGGATCTGGCCAGATCATGAGTTGGTACATGTCAAGCGCGACTGGAACGGTAGCGCTGATAGCCTAGC
CAGCGCAGCACTTCAGCGACAGGCCGGTATCATGGTGGAGGAAGCGGTGGATCTGCAGGATCTAGTCACGTTGAACCGCCTAGATGAGATCCTGGTTGTG
AAGCGTGAAGAAGACGTCTCCGTCGCACGTGTCTCACCAGTGACAACCCGAGCACGTGCCAGATCCAGATCCAACCCGAGTGTATTGCAAGAGGAAGTAG
TGCGGGATCTCAGGATCGCCAGGATCCGCCAAGCGCAGGACGAGGAGGCGTGGATCTCCGGTCTGAAGAAGTACTTAGTGGGCGATATGCAGGATCTGAC
CCAAGATGAGGCTAGATCCTACAGTGCTATCGCGATGGATTATGAAGTGGACCTCAACGACTTACTGTTCTATTGTCCTCCTACGAAGAAGGTGGAGGCG
GATCGCGATGGATTGATGAGGTTGGTGCTGCCGGAGACTCTACAACAGGATGTCCTCCACCATTACCATGTCAGTCTCGAAGGAGGTCACCAAGGGATCG
GCCGCACCTACCAGCGGATCCGGGATCGCTTCCACTGGAGGGGATTGTATCGGAGTGTACAGCGATACGTCGGAGAATGCGTGGACTGTGATACCGGCAA
AGGGCGACCTGCGATCCAAGGTGAGTCGCCCGGTAACATCCAAGCCACGTACCCGTTCCAGATTATAGCGATGGATCACATACCGTCGCTGCCCAGATCC
AACAAGGGTAATACGAGTCACTGATCTGGGTGGATCTGTTCACTGGATACGTAATCGCGAAGGCCAGCGACTCCAGGACGGCGCAGACGATCACGGAATC
CTACGAAGAGTGTGTATTCAGACGATTTGGTGCCAGCGAGGTGATTCGCCACGACCGTGAACCGGGGTTCATGGCCGACTTCTTTAGATCCTTCAACAAG
ATCCTTGGTCAGCGACAACGTGCGACGATGGCGTACAGGCCGCAAGCAAACGGAACCGCTGAGCGCATGGTGCAAACAGCCACTCGCGCTCTGAAGATGT
ACGTGCAGGATCTGGATCAGCGCGATTGGGACGACTACGGTGAGCGTCTCACCTTCGCACTCATTACCGCCCAGGATCGGATCCGAGGAGAGACACCATT
CTACTTGGTACACGGCTGGGATCCTAGATCCACGCTCGAGGCTACGATCCCGGTAGGCAGCACTCGCCGTCAGGATCGGGGTCCGCGGCGGTGGCGATAC
CAGATCCAACGCCATCATCAGCAGGCACGGGCAGAAGTCAACGCACGACTGCAAGAGGCGATCTCGGATCGGGCGGACCGGCACAATGAAGAGGTCCGTC
CGCACCAGATTGAAGTTGGATCCAGAGTTTGGTTGTATTTGGATCGGGTGAAAGATATGCTCGCAAGTTGGCTCATATGTGGCACGGTCAGTTCCGCGTG
GCGGAGAAGGTGGGAGAATACGCTGTGCGGATCGAGACCCCTGGCACGGAGTACCGGCTGTTCCCCGTGGTGCATGTTTCCAAGTTGAAGCTTGTGAAGA
ATTTCCCAGACCGACCCCAGATCCAGTTGACCGAAGGCACTACAAAACGATACGACTTTGATGAAGCACTACTGCCGGAAGACAGCTGGATCCAGGATCT
AGGTGAAGATGAGTACGAAGTGGAGAAAATTACCGACATGAGGACTGGAAAGCGCACTAGGTACGGCCGGATCCACCGTGAATTCCTGGTACACTGGCGT
GGATACGAAGATCCATCCTGGGTAGATGAGGCACATCTCAACTGTGGATCTATACTGCACGAGTTCCTGCGAAGTCGCACCAACCGGATCCGGTTCGGTG
CGATGCAGTCTCACGAAGAGCAGTGAGACCGGAATCCCCCAGAGTGGGTTGGCCACTTTGGGAGAAGAATGTGGTGATGGATCTGCAAGGAGGTTGCAGA
TCGA