Description :
From Genome Similarity Track
Location :
Scaffold_46:210563- 215715
Transcript NameFunction/comments
Hyaar_Emoy2806125PREDICTED: rho GTPase-activating protein 27-like
Hyaar_Emoy2806126hypothetical protein
Hyaar_Emoy2806127oxidoreductase

Sequence
5152 bases(100 bases per row)
ACCGGTGCACACTTTTCAATGTTAATCGGTGAAAAGCCACTCGTTCCTCTGCTTCTGCTTTTTGGCCTTCTTCTCCGCCGATATTTTCTTCCAGTCAATG
TTCTTGCGCTTCAACTGCTCTTTTCTACGCCGTGCTTCTTCACGGTTTTTCTCCAGTTCAGTCATATCAAAGAAGTGGCTCATTTGACGCCCAGCACGAT
CAGCCGCAAGGCCCGCATTTTGCCAGTATTCGTCACCCCCAAGCTGCTCGTACTTCCCTGTAAGCCGATTGAACTTTGCCCGTGCTGCGTAATTTACACC
AGAAACGGTCTTATGACCTGCAACCGTCGAATCTGGATCAGGAAGCTTAGGTGGAACCCAACTCGCCAACTACCTCAGCAACAACACATCAGTCGATTAG
TCACATGTGCATGGCAGACTGTTAACCTCGAACAAACAGCTATGCAAACTCACCCCCGAGACAATTGGTGCGTCTGGCTTGGTCCACTGTGTAACTCCCG
TGACCACATTGTGGTAGTAGTACCGCTGCGTCTGTGCGTCGACATGCTGTTGCCATTCCGCTTTTGCTGTCCGAGTCGCATCTGCAATCTCTTCGTCCAT
GCCAACCACAGCAGCAGGAGCTTTGCTATCGATGCTGCTCAAGATGCTATTCAGTCTGCTAAGATGACCCGACGGATCCAGCACTTGCTGGGTCACACGG
GCCAGACGTTCAGTATGCATCCGGTTCAGATGGGTCCGGTACTCAGCAGACACGGGATGATCCGACGATAGACTTACAGCTGGTTGTGACTCCTCGAAGT
CCTCAGGCTGATCCCATTGCGTCTTTCCTGTACCGGCGTTGAAGTAGTATGGCTTACCACTGGCAGCATCCATATACTTCACCCATGGTTTAGCAGCACC
TTTACCGTCTTCTTTCTCCTTCTCTGCTTCTTTAGCTGTACCTTCAGCTGTACCTTCAGCTGTACCTTCAGCTGTATCATCGCTAGACACTAAAGGTGCT
CCATCTTCTCCTTCATCCTCTTCCCTCTTCTCCTCATTTACCTGATTTGTCTCTTCCGTATCGTTGCAGTCTCCATTCATTTCTTGGATTTTCACTGGTA
ACTCCCGGTCTGGTACTATAATATCGTGGTCGTCGTCATCGTTTTTCTGCTTTTTGCTCTCTAGGGTCTCCAAATTAGTCGGATTTTTGTCCGTTTTATC
TTTTTCATTATCCAGCATAAAATCCACTTCGGGTTTATCCCATCGACTGACGCCGTGAACTTCGTCGTGATAATAAGTGGCTCCAGACGCGTCGTCCACA
AACTCGCGCCACTTCGGCGACTTGTGCTCCTCGCTTGCCATTGGCTCCTGCAAAGTGGATACATCGGATGGGACGTCCCATGAAGACTCGCCTGTGCTTT
CGTTGTAGTAGTACGTGGAGCCTGATGCCTCATCCACGTGCTTCTCCCAGTCTACGATCGCCATTAGAGTGACGCGTAATAATCGCTTCAATTAAAGGTC
TGTATTTGAGAAAAATGTGGTAGCAGTAGCACTATTTACTGTATTATTCAAGACGCGCAAGATACTTTAAGCCCACTAGATAATTATGACCCACAAAATA
TTGAACCCGCAAATATTCTTAACCCGCGAGATAATGTTGACCCGCAAAAGACTTTCAACCCACGAGATATTTACGACCTACGAAATATTCTCAACCCACA
AGATATTTTTAATTCACGAACTATCGATGATCCACGAGATATTCACAGCTCACAAAATGTTTACATCCTGCAATTTAGATTACGACTTATGCGATAAGAA
GGGATGTCGTCCATAAAGGGACGCAAAACTCGAGTGCGAGCGTTGTGTTTAGCTCATTCGGACCTGGAACACTTGAAGTGCTCCGGATCGATAGCAAGCG
GCAGAGTGCAGCAAATAGAATTCCCACGTCCGTTTAAATGACTCAGGAAGAGACGGCATTTGCTGCAGTGGAGACGTTGGGTCAGTTGCCGCGGCTTGGC
CAAGTGAACGCGGTACTGCGTCGTGGCCCCATTGCGCTTGGAAGCGGCGGTTCCACTCGAGAAACGTGCGCTCATAGTGCTCCGAGTAGCCAATTGTGTC
TTGCAGTGTAAACCCCGTCTCTCGAGCTAACCGCCGCATGCATGGCAATGTGATTGCGTAGCACGGGAATGCACTATGTACATACTTGTTCGTCCAGGCG
TGGGTCGTCATGTGCGCAGCTGTGCACACGCTCAACTCCAGCAAAGTCGTGCCGTTTGCGGTCTGCATGTGCTTTAGTGCTCGTAGGAATTGTATTCGCT
GCGTGTCCGGTACAGTTTCTATCACGCCGCACAGTGTGATGCGATTGAACTTGGACGTACGGTAGCCACCCAAAAGTGACAGTAGCTGTTCGGGTGTCTC
AGTGAGCACGAATTCCATTTGACTGAAGACGTCAAGCTCACGGGCGAATTTCTTCGCGCGCGCTAGTTCTTGAATCGAGGACAACACGCATACGACAGTG
GCGTCCAGATGTTGTTGAGCGAGGTAACAGCCCACTCCTCCCCATGATCCGATACTGATATCCAAGACGGTGTGGCCAGCCTGAAGCAAGATAACGGACA
CAGGTGAGAGGTCGTCCACCACTTCGACTGGACGGCACTATTCGATCAGACACTTACCCGGATGTCGAGCAGCTGGTCCAAGCTCGCAAGCTTGTTGGAT
TGAGCAACGTGAATCGTGGCTGTCCCCGGAGTCCACATCCCGAAGCCTTGGTGCAAGTATCGGTCCATGTAAGCTTGTCGAAACTCGGGGCAGAGGTCAA
ATTGCTCCGACACGGCACCAACAACAAGGCCCATTGATGAAGGTGGGTAGTTAAACAAGCGAGCTGCCAGTGCTACAAAACGAGCGCTCCAGGATCGATA
CATGTCCTGCCTGCCTTCCATGGGGATGGTCAAAAGACTAGCAACCATATCGTCTAACGTACGGGCAGAACTCGTCGCCCACAGACAACCCACATAGGAT
TCACCGATAGCCACGAGCCCCTCGCTCATCCAATCTAGCCAAAAGGAGTCGTTTCGAATGACAAAGTCCTGAGACAGCCATTGATACCCGAGCAGATCGT
AAGACGCCGAAGCTTTGGATCACAGCAAAGTCATTCAACGTACCACATTCGGTCGGATCCCGCCGCTGGAGAGCAGGCGACACATGATGGTCTTGGCATT
CTTTCGCAGCTTGGGCAACGACAGTGACCGAATTAGTTGTAGACAGAACAGAATAGCCCCCGCAATGGCCGTGGCAACATACACCCAGAAGGATCTCTAT
CACAAACAAGCATCCAGAGCAGGTGTTGATGCTATTAGCTTCGGCTTAACAGCAATCATATCCTCCTATCAACTCGCGACTACCTGGTGTGCCAGCACGC
AGAAGAGAGGGACAAGCAGGTTCAGCATGAGCTCCATCTTGTAAGCAGCGTTCCAAAAGTGCTGCGAACGGGGCGGCGAGAATCGGTAGATGTGATCAGC
TTTAGGGAAGAGTCCTCCTCCAACCACAAAGTGGCTCCACAGTCTCGACGATCTAGACAACAATAATAACGACAACACACCACCCATCACACAGCCAAAG
AACTCAGTCAACACTAGTGTGGCAATGCACCGAGACAACATCCATCCCGGTCCTTACACTAAAGCAGGGACGCTCATCCACACGCGAACAAGAGGCAGGT
AGCACGACACGAGCATCATTGGCACCAGGAGATGGAGCACAAAGTCTCCGACACGAGCTGCGACGCCCAGGACCGGCGAACTGGTCCAGACCCCGAGCCA
GCCATTGAGAATCGCCGTGAAGGCGTAGCGGTCGAATACTCGCAGCGAGTACCAGCCAACCATAATGGTGATGCCCATGGACGTCGCGATCCCCAGCGCT
GACTCGGACGCCAACGCGTGAGCGACGGCAGTGAAGACGAACCAGCAGTTGGTGTACATGGTGCGGATACCCACGAGTGGTGGCAACGTGACGACACCAA
ACAGGAGCGTCACGGCCAATGCTGCATCCATGTGGTCGTGTATCTGGACAGCGTCGTGGCTCGCGCGACTGAGAGAGGATCCCCATCCTAGTGGTAAATC
CATCAGGAGCTACTGAGGAGCGAAAAGCAAAAGTGAAGTCGATGGGGATAGCTGGAGCGATTCGGGCTGAACTTGGATTGAAGACATCCGGTGATTTGTG
GAGAGGCTTAGCAGACTGGCGTTGACTTGGGTCTCGTGTCCGAAACAGGTAGCCGTTGTTGGCCTCTTCTGACGCAGCTTTTTGTTTTCTACAGATCGCC
AGGAGCTTATCTTCCTTCTTGTCTCGCTGCTATTGATGCTGTGTCTGGGTGTCTGGACAGTTACAACCTCGGTGCGAGCAAGCAGGCGACTACAAAGTCG
TGGATACCTGCTTGACACCCGAGTACGCACAATGTCGGGATGGTGAGGTTGTAGACCAACTCGATCTTGTGTGCTGCATGCCAGAAAGCCTTGGGCCGCG
GAGGGTAGATGTGATAGATGTCGTTGCCCGAAAGCGAGAGATCGCCGTCTGCAACCAGCTTGATCCACAGCTGGGAGAAGCTATGAGGATGGACAAGCAC
ATAGGAAATGGGGAGATACATCAGCACGCATGCTTTATCCAACCAGCAACTAGTAGCAGCAGTTCACTCACAGCAGAATAGGAGCAGTCATCCAGATCCG
CACAAGTGGCAGGTAGCAGAAGACGAGTGCGAGCGGCACGCCCATGTGCAGCAGGAGGTCGATCGAGTTGGCCAGTAGTTGAAAAGACCCGTACTTGCTG
ATGGCACCAAACCAGCCTTGCAGGATGCCCATGAACGTTGTTCGGTCAAACACTCGGAGCGAGTACCAGCCCATCATGATCGTAAAGCCTAACGACGTAG
CGAGGCCTAGCGCTGCCTTCGACTCCGTCACATGCGCCAGTACCGTGAAGATCGTCCAGCAAAAGGTGTAGAGGACTCGCACGCGCACGACCACGGGCAG
CAGCGCCACGGAGAAAAGCATCAGGACTGCCAGGACTGCATCTGTGCTCAATATGGTGGACGAAGGGACGTGCTGCTCGCTATCGCGGACTCGAAGGACT
GTGCGGGTCAGCGTATCGTGTGCAATCGTGAGGAAATAAAGAGTGTCCATTG