Description :
From Genome Similarity Track
Location :
Scaffold_65:210550- 212058
Transcript NameFunction/comments
Hyaar_Emoy2807545protoporphyrinogen oxidase, putative

Sequence
1508 bases(100 bases per row)
CAATGTCAACTCGCGACGTGGTCGTGCTTGGCGGCGGCATCTCTGGTCTCACGCTCGCCTACTTCCTGCGCCAGGCGCTGTCCAAGACCGTATCTACCAC
TACAACACGGATCCACGTACTGGAAGCCAGTTCCGTCTCGGGCGGATGGGTACAGACAGCTAAACAGGAGGGATTCCTCTTTGAAGAAGGACCCCGAGGC
TTTCGACCGTCCCGGAACGGTGCAGAGATGTTGCGATTGGTCGAGGAGTTGCAGCTACAAGAGAAGATGCAGGCGGTTGATCCAGCAGCACAAGCGCGGT
ACATTCTGCGCAATGGAAACGTCGAGAAGCTGCCGGACTCGGTGCTAGATGCGCTGCGTTGGCCGCTGTCGCTTCCAGTGGCTCGTGCAGCTTTGCGCGA
GCTGTTTGTGAAGCCTGGAGCAATGGAAGAGGAGTCTATCTACAATTTTATGAGCAGACGGTTCAGTCCCTTGGTGGCTGAGAGACTGCTGGATCCCATG
GCTTCGGGGATTTTCGGTGGCGATATCAGGAATCTCTCGATACACGCGTGCTTCCCCATGTTGACTGACTTGGAGAGAGAACATGGATCTGTAGTGAGGG
GCATGCTGTTTGGTAGGTACGGACAAGGCGATACGCTGCTGGATGGTTCGAAGAAATCCGAGTTTGTCAAGAAACACGAAAAGTCAGTGAGCGTGAGTTT
CACGCATGGCATGACCACACTCATGGAATGTTTAGAAGATAGGATTCGTGCCGATCCGATGGCGACTTTTCAACTGAATACGAAGGTGACGCGGCTTGCG
GTACAGGGCCATAACAGCGTGGGGTCGGACTTTGTGGTCGAGAGCAAAGATTCCGCATCCGGCGAAATCCGGGAGCCGATCAAGGCCTTGCATGTGTTCT
CTACTATTCCTTCTTGTTGTCTGTCTCCAGTGGTAAAGGATTCGGCACCTGGCTTGGCTGAGGCACTTAATGAGATTGAGTTTGTTGACATGGGGACTGT
GCACGTTGGGTACAACGAAAAGGTGCTCCGTACTGACGGCTTTGGGTACCTCATCCCGAGCGTCGAGCGTGAGAAGGTGCTTGGCGTCGTGTTTGACTCC
AACACGTTCCCCATGCAGAACAGTGCAGGGAAATCGCAGACGCGTCTGAGTGTCATGAGTGGTGGCGCGCGTTATCCGGAAGTGGCATCGCTGCCTGAAG
GTGAAATGGAGCGCAATGCGCTGGATGCTTTAAAGCGGCACCTTGGTATCACGCGCAAGCCTGACTACGTGCGTACCATGGTACTGAAGAATGGAATTCC
GCAATACAATGTTGGATTTGGCCAGACGCTGCAGCGTATTGAAAAGCAGGCTGCTCGCTGTGTGCCGGGTTTATATCTGGGTGGCAACAGCTTTTACGGC
ATTGGACTGGCTGACTGCGTGACCCACTCAAAAAGGCTTGCGCTTAAGTATGCTAAGAGCGTGTCGTCTTGAGTGGACAAAGCAGTGGTGCGTGTGCACC
TGTTGGCG