Description :
From Genome Similarity Track
Location :
Scaffold_119:21052- 22400
Transcript NameFunction/comments
Hyaar_Emoy2810142gag protein

Sequence
1348 bases(100 bases per row)
CTAAGTCTTCCTCTGACTTCAGGAGCTGTGTAGCTCCGCTACACTTGGTAGCACTTGTAGTCAATCTACGCCTGAGTCTTTAAAGAGTGATCGTGTGTGA
GGATAGAAAACCCCACTCCCCTCTCTGAGGCCCAAAAGGTCGCGCTTGATAAGCTGACCGCATCTTTGGGTCGAGAGTATGTGGAATTCCTTGTATCGCA
AGGCCCATAGGTGCTGACTGCACGTGTTGAGGGCTTCTTGCAGTATGAAGCGTCCCTTCTAGGGCAGGTCCAAGACCAAATGGCGTCGGCTATGACTATA
CGCTATGTGTCTGTTTCAGACGAAGAGACTAGGCCTCGTCCACTTAGAGTGGAAGTTAAAAACTACTCAGGAAAGGAGGGTGAAAACCTCATCCTCTGGA
TCCGTGAGATTGAGATGGTCATGAGATCAGGCTTGATCAAGCTTGACCATCAACAGGTCTCGCCGGTTATCTCAAAGCTCGATGGAAGAGCTAGAAAGTA
GGCCTTGACGTGTATCACGTCGGTCGACTTAGCGTTTCCCACATGGAAGCCGCTTAAGTCACAATTGGTACAGGTGTTTTCACCACCTAACCAGGCTTAC
CGCGTGCGTTCACGCTTTTTATCAACCCGTCAGGGTAAGAATGAGTTAACGGACCATTTCCAAGAGCTGAGAACTCTCATGGCTGCGATGCAGTCTGACC
CTCTGCCTGAGACAGTACATGTGACTATATTCATGGAGGGTCTCCGTACTGGCATTACCAGAACCGAAGTCTTTCGGGTTCACCCCTCTACAGTCGAAAA
TGCTGTGAGAATTGCTCTTAATGCTGATCATAACTTCAAGTCGGCCAGACTTAGCTGGAATGGGTACAACCCTAGTTCTGCGAGAGAAAACTTCACGAGT
ACTCCGGCCGTTAATAGGCCGGAACCGATGGATCTCAGCTATGCTGAAGATGAAGGTGAAGTTGAACTTCAAGCTGATGAGCAGCAACGTGTTGTACAAC
GGTGTTATACGTGCGGAAGCACTAAACACTTACGGCCTGGTTGTCCTTTGCGTAGACAGCGCCAGGCTACGAGTCAACACTCTACCCCGAGCCAGAAGTC
TGGCATGGCACGGGAAAATGCCGACATCCAGTAGGCGCGGGGCGCCCTACTGGGGAAGAACTAGGTTCTGTAACACCTTTAGGAGGTAAAATTGAACAGG
GCTTAGCCCCAAAGAGTTCCGTACCTACTGGTATGGAGCGTGGATACAAGGCTGGCTTGTTGGTCGCTGAGGCGAAAGTTAAAGGCTTTGAAAAGCCTTG
GTCGATTTTAATCGATTCTGGNGCGTCTTGCAATTATGCTCGACGTCG