Description :
From Genome Similarity Track
Location :
scaffold_1215:2105- 3605
Transcript NameFunction/comments
Pl_101046Major Facilitator Superfamily (MFS)
Pl_101047hypothetical protein PHYSODRAFT_339981

Sequence
1500 bases(100 bases per row)
AGGAATTGGCACGGTTGTATGGCAAGGAAAATGTAAATGCCATGATGGGCTGGATCCAAGCCAACGACCGCCGATCCAAGCTGCCGTCGATGTTGAGTGG
TGCGTCCGACAAGGTACACACCGAAACCAATTGGACTATCCTCACCAACAAGAAGTTCCGTAAACCGCTGATCATTGCACTGGGCTTGACCTGCATTAAC
CAGTTGGTGGGCATCAATGCTGTTTTCTTCTACTCGTCGTCGATTCTCAAGGATGCTGGAATTTCAGACTCTCGTGCCGGTCTAATGATCATCGATATTC
TCAACGTCGTGCCCGTGCCTATCGCCGCCGCATTAACAAAGGTCATGCGCAAGCGTACCATGTTGATCTCTGGTATCTTTGTGATGGTACTGTGTTGCAT
TGGTATGACCTTTTCGTTGGTCTACAGCGTTGGTTGGCTCTCGATTGTGTTCCTCGGCGTCTTCGTGGTTGGCTACGATTTGAGTATTGGTCCGCTACTT
TGGCCGATCGTCGCAGAGCTTTTTGCGGATTCTGCTAGAGGTGCTGCCGTCGGAATATGCATCACGATGAAGTGGATCTGCTCCCTCATCGTTGGCATTG
GATTCCCGTACGTCGAGGAGGCAATCACAAACTACAGTTTCACGCCGTTCTTGGGCACCACCATCTTGTCTATTATCTTCATCTACTTCATGGTACCAGA
GACGTCGGACATGACTATCGCTGAGATCCAAGATGGTTTCCGTAGCAACCGCAGTGTGCAGTCGTCGAGTAAGAGTCAAATGTAGGAAGCGAAAAATGAA
TGAAAGTTGTTGTTGAACTCCATTCGTGGTTGCGCATGTCTTCCTACCTCATCGTCTAAGACCATAACCCAGTCCAAGCAATGGACGACCAAGTTTAAGC
ATCCACAAGTCCCTTCCGTCAACATTTAGCAATGATGCACGATAATGTTCAGCCACTGGAGTGAGACCACACGTAAGAACCAGCGGTATTTCGCAAGCAC
CCACAATTTCGCCTTTGATCGCTTCTACACTTTGCTTCATTGGTGCTCGGTCGTAGGAGTAGTTTCTTTTGTTTTCATTGACAACATGTAGGGAAATGCA
TTAACCAGCTAGTCTTACTTACATGCTACACTGGTTCACACGCATCCTTTGCTTCATTGCTGACTTTTGACCGAGTGCAAGTTCTGGTCGCCACGAAAGC
CGTTCTGAATTTCGGCAATCGTTAAATCCGACGTCTCGGGAACCATGAAGTAGATAAAGATGATCGACAGGATGGTGGTGCCTAGGAATGTCGTGAAGCT
GTAGTCGGTGATGGCGTCTTGGACGTATGGGAACGCGATACCAATAATTAGTGCACACATCCACTTCAAGAACACGCAGATACCAACTGCTCCACCACGT
GCCGAGTCAGGGAAGAACTCGGCGATCATGGGCCAGAGTAGGGGGCCGATGCTCACGTCGTAGCCGACCACGTAGATTCCGAGCATGGTGACGGAGAGCC