Description :
From Genome Similarity Track
Location :
Scaffold_194:21043- 23624
Transcript NameFunction/comments
Physo_144527putative polyprotein

Sequence
2581 bases(100 bases per row)
CCACACCAAGGAGCGCTGGAGCGCGAGGATGGCGACCGAAGTTGACGAAGAACGGGGACAGCTTGGTCGATGCGTGGACAGCGTTGTTGAGGGCGAATTC
GACCAGGGGCAGGAAGATGCTCCACGACTTGAACGACGTAGCGAAGCCGCGTAGTATGTCTTCAACAACACGGTTGGCGCGCTCAGTTCGGCCGTTTGGC
TCCGGATGCGACGCGGTGGACATGCATAACCGCGTCCCCAGCAACTGGAAAAGCTCTCGCCAGAAAGCAGACGTAAAGCGAGGGTCGCGATCCGATACGA
TGGAGGACGGAAGCCCGTGGTGGCGGTACACCACGTCCACAAAGATCGCGGCGGTTTGCTTCGCCGTGATGCTGGCAGCAACAGGAGCAAGACGGAGCAT
CTTGCTAAACCGATCAACGAAGACAAGCACGCCAGTGCGCCCTTGAGTGTCTCGGGGCAGCCGGAAGGCGAAGTCCATGCTGACAGACGCCCATGCGTCT
GTGGCGACGGGGAGAGGTCAAAGCGGAGCCTGCTTGGACGGATTCGGCTTCACGCGTTGGCACGCTTCGCAGGAGCGTACCCATTTCCGGACCCACTTGT
ACATATGCTGCCAGTAGAAGTCTCTGGACAGCGACGCGAACGTCTTCTCGCGTCCGAGGTGGCCGTCGCTCGGTGTGTCATGGAACGCGTGGATCAGCCA
AGCTCGGAGATCGTCGTCCAGAGGAACGACGATGCGCGGGGTGTCTTCACGGTCGACGCGGTACGTGAGCAACTCGCCGTCCAGCCAGAAGCGGTCGACG
CGGGAGCGGCTGCGTGGAGACAGCTTGCGCTTCGCCACGGCACCAGGGTCTCGCAGGAACTGGGTCAGCTCCAAGCAGGACGCGTCCTCCTTGTACGCGT
CCACGATCAAGTCACGGAGCGGACTGGTCGTTGCAACCTCAACAGCAGCGACGTCTTCGGCAGTGCATATGGCGCATTCGTCGTCGTCCTCGTCGCCAAC
TGCGTGACGACCTGTCTGCACGTAGTCAGGCCGACGTGTTATCGCGTCGGCAAGGATGTTGGTCTTGCCCGGCTTGTAGTACACGACGAAGTTGTACTCG
GAGAACAGGGACAACCAGCGCGCCATGCGCTGGGACAAGTGGGGGCTCTTCGTCGCTGTCCTCAACGACGCGTGATCGGTGTAGATTGCGAAGGTCTGCT
CGCCGAGGAGATACACGCGGGACTTGATGAGGGCGTAGCGCATGGCCAGCAGCTCCCTATCATGGACCGGATAATTCCGTTCCACCGGCTTCAGCTGACG
CGACTGGTAGCTGATGACCCGCTCGCGTCCTTCGTCATCGAACTGTATCAAGGCGCATCCGATCGCGAAGGCGCTCGCGTCGCACACGACATCGAAGGGC
TTCGAGTGGTCTGGAAGCATGAGCACGGGCGCGGTGGACAAGCTCGACTTCACCGCGTCGAAGGCAGCTTGGTGCTCGGGACGCCACGACCACGTGGAGT
CAGCCGTGAGTAGTTGAGGTAGCGGGCGGATCGTCGAAGCGAAGTTCTTCGAGTAATGGTGAAGATACGTGGCGAACCCCAGCCACTGCCGGAGCTGCTT
CTGGTCCTGCGGCGTCGGCCACGCGCAGATGGCCTCGATCTTCTCGGGGTCGGCGCGGACACCGTCCTTGCTGACCTAGCTCCCGAGCACAGGGAAATCT
CGGGAGCGCAGAAGATGCACTTCTTCAGGTTGGCGTACAGCTTGTTCTCCTTCATCATCTCGAACACCTTGCGCAGGTGTTGTAGGTGGACCTCAACGTC
CGTCATGCCGTCCTTGGCACGACTGTGAATGAAGATGTCGAAGTAGCTGGGCGCGAAGTCTCGGTACGGCCGAAGCAAGTTGGACACCATCCGGTTGAAG
GTGGCGGGGGCGTTCTTGAGCCCCTGCGGCATCACGAGCCATTCCCACAACATCCCGTTGGGTGTGCTGACCGCTGTCAGCGGCACATCGTCTTCGCGCA
TCAGGATCTGATAGAAGCCATCAATCAGATCAATGACACTGTACTTCGTGCTGCCAGACATGGTGTCCAGCACCATGTCCTTCCTCGGGATCGACGTTTG
CGCCGGTATGGTGACCTCGTTGAGCTTGTTGAAGGCGTGGACGATTCTCCAGCCGCCGGTTGCTTTCTTCACGCAGAACGTCGGACTGGAGTGCGGCGGG
AGACTCTCACGAACGTGGCCAGCTTGCCGGCGACTCTCGAAGAAGGTATCAATGGCTTCGACTTGGTCGCGAGGAAGCGGCCACTGCCGCGTCACGCAGT
ACATCGCACCGGGCACGATATCAATCTCGTGCCGAACCCCGCGGTCGGGTGGAAGAACGGCTGGAACCTTGTCCACGAAAATCTCCATGAACTCGCGCAC
GAGCGGAGCGACCGGGTTGCCGGCCATTCTTCGGCTCGGCTCCTTTTGGGTGCGTCCTGGCATCGGAAGCTGGGTCCGACGCACTGGTTGTGACGGCTGC
AATTGACTCGGCGTCCTCGGCGACGATTATGCACACCTGCTGGATCTCGCCCTTCTTCAGGTCACGGAGGAAGTGTTTCCA