Description :
From Genome Similarity Track
Location :
Scaffold_11:21041- 22402
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G005158Similar to AVT1: Vacuolar amino acid transporter 1 (Saccharomyces cerevisiae)

Sequence
1361 bases(100 bases per row)
AAACAACGACTTGCCGGTGTAGTACATCACGTACAACCCACAGACTGTACAAAGCAGAATGAGGAGCAACGCGATTACGCGTTCGTACCATGGGACCGAC
TTCCATTTCACCTTCAAATGAAACACCAATGGGAGAATCAAGCAATTCATAGTAATCGCTGATGCGCCGATGAAATCTGCGAGGTCCAAAAAGTGATCCT
TGAACGCGATGGAGACCAACACCAAGACCACAATCATCACCGTTCGAAGCAGCACGTAACGGAGGACGTTCCGATGCCCTTTATACTCAGATAAGTAATC
TGTGTTGTCTGACTTCATAGCAATAGCTTCAGCGTGCTCAGTCGAGTCGCCCGAGTGTGGCGTAGACTGGGACACGTACGACGCCTTCGTCAGGCCTTGT
TGGTCTTCAAGATCAGCCTCCAAAATTTCAAGACTTTCAACCTTGTGCATTCCCAAGATCATCCGCTCGAGCATAAAGAACGCCGGATGAAGAATGCACG
AAAAGACAATCACAATGTGCAACTGCATGAAGATATACGCCATCACAACCGCGCCACGATCCGCAATAAACCCGAGCAAAGTCATTCCAGTAGAACCCGA
ACCAGCGATCGAGAAGAGCAGGTTGCCCGAAATCTGGCAGCCAGCAGCACTGTAGCCAAGTGCAGCGAGCGTCAAAAAGAAGCACGTGACGATCGAGAGC
GAGATGAAGACAACCTTCGGCATCCGGTGAGGCTCACTGTGTTCACGCTGGAGATCTGGAATCACAATTGCAGCGCCGTACGCCAGCGACAGGTTACCAA
ACGTAGTCACGATCTGGTGAAGGCTGAAATCGGGGCTTGGAGGAGCAGGATGGCCAGCCATACCATGCATGATCACAGCAATCCCCACAATGTCGGCGAC
GATCGTGCCAATACAACCGGCCAGCATGGCTCCGGCTCCTTCCTTCATAGTCGGAATGAGCGCTACTGGAAAAACCACGAGCGCCATGAACACGATCCAA
AACGTTTGACTGAAAGCTCCTGGGAACAGGGTCTCGAACAACATACTGCCGAGTACGAGGAACGCACATGGCAGCAAGAGGCACACAGCCATTTGAGAGA
ACACCACAAGATACCGGCCAGTCTTCCCCATCACCCACTCGCCAATATCACTGTAGTTCCGCACACTCTTGGGCGCCATGAGCATCACTCTTGAAAGCGT
CACACTCGCATACACGTTGGCCGAAGCCATGATGAGAAGCGCCACAACCGCGATGTAGGGACCTGCGCGTGCAAAGTTGGCAGGCATGCCGAGCGTGCCG
ATGCCGCAGATGCAGCAAAAGAGCGTAAACGTGACCCTCAGATCTTCCTTTGTGTAGAATG