Description :
From Genome Similarity Track
Location :
Scaffold_988:2104- 8231
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_988-snap-gene-0.2O-phosphoseryl-tRNA(Sec) selenium transferase (Selenocysteine synthase)
Pytve_DAOMBR484snap_masked-pve_contig_988-abinit-gene-0.4Eukaryotic translation initiation factor 3 subunit
Pytve_DAOMBR484snap_masked-pve_contig_988-abinit-gene-0.6Eukaryotic translation initiation factor 3 subunit

Sequence
6127 bases(100 bases per row)
ATGAACGGCAAGAATGAGCAGCTCGCCGAGGCGCTCGTGCCGCGCACGTACGTGCAGCAGGGCGGTGCGTCGCTGCGCAGTCGCGAGCAGCTGGTGACGA
CGTTATTGTCGCAGCGGCGGCTGCCGGACGTCGGCTGGGACGACCTGAGCGTCGAGTTGCTGCTGCTGGAGCTCGCGGCCATGGACAGCAACAACTTCCG
GGGCTCTGCCGGCGCCGGCGAGCGCGAGGCGCGCGTCTTCTCGCCGCTGGTGGCGCGCCGCCACTTCCAGCTGTGTCATGGTGTTGGCCGCTCGGGCGAT
GTGGCGGCGGTGCAGCCCAAGGCCGCGGGTTCGTCGCTCATCGTGCAGCTCGCGAACGCCTTGGCTCGCGATGCGTTGCACATCGCGGGGCTTCGGGCCG
CCAAGGCCGCGCTCGTGCTCCCCGTAGCCACTGGCATGTCGCTCACGCTCGTGCTGCTGGCGCTGCGCGGCGAGAACCCTGGCGCCACGCACGTTGTTTG
GCCGCGGATCGACCAGAAGTCGTGTCTCAAGGCGATCCAAGCGGCGGGACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCGTGGTCGAGAACGCGCT
GCTGGACGGAGGTGAGCTGCGCGCCAACGTCTCCAGCATCGAGAGCGCGATCGACAGTGTTGGAAGCGACAGAGTGCTGGCGGTGGTGACCACTACGAGC
TGCTTCGCGCCGCGAGGCTTCGATCGCGTCGAGGAGATCGCGCAGCTCTGCCAGGACCGCTCCATCGGTGTGTGCTCTTCCATTCGAATGGTGCCATGAT
GCGGAGTAACTGACGGCTGCGGACTGTAGCGCACGTGGTCAACAATGCGTATGGTGTGCAGTCGTCCAAGTGTGTGCACGTCGTGGAGCTGGCCATGCGC
CGCGGCCGCGTCGACGCCGTCGTGCAGAGCCTCGACAAGAACTTCCTCGTGCCAGTGGGCGGCGCCATCGTGTGTTCGCCCAGCAAGACAACAGTCGAGC
GCATCGCCAAACTGTACCCGGGCCGCGCGAGCATTACGCCGACACTCGATTTCTTCATCACGATGCTGCAGATGGTGAGTCTGGTTGGTTGGTTGTCTGC
AGCGACAACGATACCGACTGTTGTGCTTGTTTAGGGTCGCGATGGCTACCAGCGACTCCTTCGCGAGCGCAAAGAGCTTGCACCGTACATGCGGGAGCGG
CTCAAGGCAGTGGCGGCTGAGTTTGGCGAGCGGCTCATCGATGTCCCGCATAACGAGGTGAGCATGCATGGGAATGCTCGTTTTCGTTTGCTCCCCCTGC
TAAGAACGTCCGTGACAGATCTCGTTCGCCATGACGCTCAGCTCCTGCTGTCATGGCATTGCCGACCGCGAGGAGCGTGCCAAGCACCTGACCTTCTTTG
GCTCCATGCTCTTTGCGCGCGGCATCTCGGGCACTCGGTGCGTCTCTACAGTTGTTGCGATTGAGACCTGTGGGGTTTAACCAACCGCTGCTGACTGCTT
GGCAGGGTTGTCTCGTGTCTCGACACCAAAGCCATCGGAGGACTCGCGTTCAACGCCTATGGCGCACACCACGACGCGTACCCAGACCCGTACATCACGT
TTGCGTGCGCGATCGGCATGGAGCGCCGCGAAGTCGATGTGGTGGCCACCAAGCTGCGTAAGACGCTCGCGGAGTGGAAGGCCAAGTTAAACTGACGGCT
TTTCCGCCATGTCAACACGGCGACACAGCTGATGCGCTCGGATCCAGGCTGAACGCATTGCTGTCGCGGTGACCCATTGCAAGCCAACTGGCGTTATCCA
AGTTGGCGCTACGGTTGGCATCCAACTCTGAAGTACTTGACGGCATTGGCAGTCAAATGGCGGGAGAAAATCGATCAACTCTGTGGGACCATGCAGCATG
AATGGCAGATCCCGTTCATATGGCAGAACAGCACTCCACAGCTCGTAGTCCGCAATCGACATCGCAGCGAAGCCGTTGGAACGATGGTCTTTGCCTCTGC
GTCCACCCATGACCAGCGTTGCAAGCCTCAAGACAATGGTACGGCAACGAAAGCGTACAGCACGCAGTTGACTGTGTCTATGTTGTTTCTCCTGTTGAAC
AAGCACACGCAGGACTAATGTTGCGAGACTGACCTGACCGACTATGATCTTCACACGCGGCGCTCTAGTGCTTCTTGGCGCCGCTCTTGCTCTTGCGGCT
CTTCTTCTTGCCGGCCGAGACAGCGGCGCCGTCATCGCTCGTCTTGATCTCGAACTCCTCGATCAGCTCGTTCGCGATCGCGTCGGCAGCGGCCGCGGCG
TCCANNNNNNNNNNNNNNNNNNNNNNCGCCCCTTGGCACCCTCAACCGCCTTCTCCGTGAACTTGTCCATGTACTTGGCCGACTCGACCACACGCGGGTC
CTCGTCCCCGAACGCCTCCTTCAGCAGCGCGTACACCTTCTTCTCGTACGCAAGCGCCTCGCGGAAGCCGCCAGCGAGTCCGCAAGCCAACGCCATCTGG
TGGAGCGTGTTGGCAGCCTGAGAGCGGTCCAGCTCGCCACGACGCAGCGACTCGCGGTGGCAGAGCAGTGCCAGCGTGATCTGGCCCACGTCCTGGCACA
TCATGCCCATCTTGAAGTACAGCGAGCTGATCTCCGGGAAGTGCGGACCGCTGCAGAACTCGAGCAGGTAGATCGCGCGGCGAATGTGGGCCACCGCGAG
GTCCGTCTGCGCGTTGGCGTGGAGGAACAGCGCGAGGTTGGCGTGAGCGAAAGCCGTGTCGTGGTAGTCAATGCCCTCCAGCTGAGTGTACAACGCCAGC
GCGCGCTGCTGCTGAGCGATCGCGCCGGTCACGTCGCCCGCATGGTACAGCACGGTCGCCAGCGATGCGCTGCACAACGCCGCGTCCTCGTGCGCAGCGC
CACAAACCTGGAAGAGCAGCGCCGACGCCTCCTGAAGCAGCTCGTAAGCCGTGGGCAACGCACCGCCACTGAGGTGGAGGCGGCCACGCTCCAGCAGCTG
CTTCGCCTGCGGAAGCGGATGCGCCGGCAGCGAGTTCTTCACCACCGGGACAACGCCTGTGATGTCACTCAGCGACAGCGGCTGCGACGAAGCGAAGTCA
TAGTTGCGGGACAGCACACGGAGACCGAGGCGCTGGCACAAGCGACGAAGCAGACAGTTCTGGTTGGCGCGGCTAAACGACGGCACATCATCGTCCTCGG
GCGTCTCACGCGGCTGGTTCCACAGCGACAGCTTGTAGTCGAACCGGTTCTTGATTTCCTTCTCAAGGCGCTGCCACACCGCCGTCGAGGTGAACGCTGG
AGCATCAGTGGCGGTAGCTACCGACTCGGGCGACGAATCTTCGGCCGAATCGGACTTGTTGTCGCTTGTCTTCTTCCCCTTCTTCTTGTTGTTCTTGGCA
GCACTCTTGGGGCTGACCACCTCGGTGTCATCACTGACACCGAGAATGCTGTTCAGAATCTGCACAAGCGTCGCACCAGGAGCCGCACGGATCGAGTCGT
TCGAGTTGAGAACGTCCGCGACGTAATGCTTGGTCGCTCGCGCAACCATCTCGACCTCCAGCAGCTCGAGGATGTACTTAGAAATGCCGCCAACAGCTTC
CAGGCGTCTGCACAGCGACGCAAGGCGGCCGAGGTAGCGCATGTTGATGCCGCACGAGTGCATCAGCGCACTCAGCGAGTGTCCGTCGGCAGGGGCGATA
GAGTTGCGGCGCACATCGGCGATGAAAGCCGGAACAACGATCTTCTGCAGGTACTCCGCCGCATCGCGAGCCGCAGCCTCGTCGGCAGCAATCTCTTCGT
CGTTTGTCGACGACTTGTACTTCATGAACACGTTCGGGTTGAGACGAACAGCCGGGATCTCCTCTTCGTCCTCCTCGTCGGTCTCAGCCTGAGTGTCCTC
AGCAGGCTTCTCCTTGTCAGCATTCGCCTCCGGCTTCTCCGACGATTCCTCCGACGATTCCTTCTTCTCAGCCTCAGCTTCCTCCTTCAGCTTCTTCTCC
GCCTCGGCCGCAGCCTTGCGAGCCTCACGCTTCGCGCGGCGCTCTTGGTTCTGCTTCCAAAGCGAGTAAAGCTGGACGAGCTCTGGACGAAGGACAGCGA
CGTATCCTTCGTCTTCCCTCGCGAAACGAAGACCGTCGTGTTCGAAAGATCCCTCCTTCGACTCCTTCTCGTCGTAGAAAGTCGAGTCCTTCGGCGTGAT
ACGCACCAAGTCCAGGACGTACATCCGCCCGTCCGAGCCAAGGATACCCTTCGCCTCGACCGGACCGCACAGTCGAACGACATCAGTGCCTGCTTCACCG
CCCGCAAGAACCGAGTCAGCCGCGTCAATTTCGGCTGCCGTCTCCTCCTCATCGTCCTTGCCAAGCGGCTCAATGCTGCGCTCCGCAATGTGCAGCTTCT
CCCCCGCTTCGAGCATGAGGCTGTGCATTTTCGGGTTTGACGCGATCGTCTTGCCGCTGTCGACGGAGCCGTAGACGAGCTTGGACGCAGCCTCGCCTTG
CAGAATGCCAGGAATCACGCTTTGCGCAATCACGCGGACGCCCAGGTAGTCAACGATCGTAGTAGCAAGCGTATGCAGGCCACGGACATCCGCATCGTTG
AACGCCTTGACGCCGAGCAGATCACGGTTCGCAGCCGAATACGCCGCCTCTTCGCCAGCCGCATCCTTCGGCGGGCTCTTGCCGTCGATAGAAATGGAGA
AGAAGATGTTGTTGAACACGTAGACATGAGCGCTGCTGTCGTCCATGGGGTTGATCGGAGGGATGTGGCCCTCCACAATCGCCACCGCACCTTGCGTCGC
GGCATCGACGAACTCGTTGACAATCTTGTACATGACACGCGAGCGCACGATTTGCTCCTTCAACGTCGCCGCGGGAAGCTCACGGCAGCACTGGTACTCC
TCGTTCCAGTCACGCAGCACGCCACGCTCGTCCATGCCGTACGACGCGCACAGCTCGTCTTCGGCGCGGTTGAGGTCGTACTCGTGCTTGGTGTTGGCCG
CGACCGGAGTGTTCCACGGAAGCTTGCCGCCAACGTTGTTCCCAGCAGCGACCATCCACTCGATCGACGACGGTCCCTGCTTCGCGAGCGTCGCCGCCTT
CGAAAGCAGCGAGTTGTACGACGTCTTGAAGGTCTCAGACGACTTGCACAGCACGTCAAGGAGCAAGTGCGAGTTGTGACCACCAAACTTGGCCGGGGAT
GGATCGAATTTGGCCGCCGTCGAGCTGTTCACGTAGAACCCGTTGACGTGCGCAGTCACGTGGAAAACGGAACTGTCTTCAGTGGTCACCTCGAGATACA
CGAGGTCGCCCGCGAGCTTGCGAGGTCCAGGCGGCGGGTTGTAGCCCGAAAACACGATGCTCTTGAGGCACGAAGGCAGCTTCACGTCCAGCGGCTGGTG
GTCATCTTCAGGCGCGGGTGAGCTGGCCTTGCCCTTGCTCTTCTTCCCCTTAGAAGGCGACGACGCCTTCTTCTGCGGAGCCGCATCCGCGCTCGGCGCT
GACTTCGCATCAGCGCCGGGGAACGAGTAAAAGTCGGCCAGCTCGGGCTTGACCGGCACCTCGACGCCCTCGAGCTTCTGGTGGATCTCACGCAGGTGCT
TCAGCTGCTGCTCCGAGATCTCCTGGAGCTTCTTCTCGTCGGCAGCCTCATCCTTGGCCTGCTCTCCGTCACTCGCGACCACCGCACTTTCGCTCGACTG
CTTGCTCTTGTCGGCCTTGGCGGCGCCGTTCGCCTGCTCGGCGGCCTCGGGTTCGGCCTCAGCCACCTGCGGAATCGGCGGGTTGCTCAGCACGTCGCGG
AAGCGGCGCACGTGCGCGCGCACCTTGCGCGCGTCGTACTTCTCGAGCACCATCTTGAGCGTCGCGCCGTCCGCCACGGCTTCGTACTCGCTCAGCTCCA
CAAAGTCGTTGAGCGCAACCCTGCCACGTGTGATGTCAGCCCTCAATTGCACCACACATGCTCAACGGACCACCGCTACACTCACCACTTGCTGGGGTCG
GCCGGATCGGCGGCTTCGAGGTGGTAGCACGTGTAGCACGCCAGCGACGGGTACTCGGCGATGAGCTGGCGCAGCGAGAGCACCGTGTCGCCGGCGCTCA
CGTGGTCGAGGCGCACGGGCGAGTCGC