Description :
From Genome Similarity Track
Location :
scaffold_423:21036- 23044
Transcript NameFunction/comments
Pl_105001hypothetical protein PHYSODRAFT_313708

Sequence
2008 bases(100 bases per row)
CACGTATTAAGTCGCTTCGTTGGTTTACTCCCTGAAGATACTTGGCCATTATCCTCCATTCACGTACGATTTCCTTCAGCAATTGTCGATCAGACTGCCT
CGTGAAGAAACGTCCCATTTTCTGTCGTACAGCTATTACAGCAGCGTGATGCCTTTGAGTTTTATCAGCAAATGCAGCTTTTTCTTGCTCATGACGCGCT
TGTATCTCGTGACATGCATTTTGAGCTGCATTCAACGCCATCTCTAGATCCATGGTCATTTTAGCTTGAACCTTCGTTGTTTCGGTCATCGCTGCAAGTC
TCTGATCCTTCTCCTCCAAAGCAAGACGAAAATGTTGTATACTCCATTTTCGCATTCCCCAACAACGCGAACGGCAAGTCAAAAATCGTTCAACCCTGAG
TACAGCAGCTCGTTGATTCCTTTCTTTTCGACTCTCAGTTCTCCAGGACTTTAGAATGCGCTTTATTAACGTCTGACACCGCTTCTCAGCAAACTGACCC
CCTTTACACCGTCGCTCCACATTCCGTCGTGTCAACTCTCGCCAACAGATAAAAGTTCTCCTAGCTGATTGTTGCATCAACTTTGCAACAAATATCGCAG
CCTGGTTCCCTCTTATCTTGGCAACACGTTCATCTACTGTGCGTTCAAATGTGGCCATCACCATTTTATTCTCCTCCTTCCGTCGTTGGTCTTTCACCAG
CGCGATCCACTTGTTCCACGCATTCTGCACTTTATCCGTCGACCACATCGTCAACGCATTCACTACGCGCTGTTGTCCAATCTTCACTCGTTGCTGCTCC
AACAACTTCACTTTCTCCTTTAAATTCTCCACAATTTGCATCTGTTCATTGTAAAACGTCCGGTACTGTTCCTTCAATTCCCCGTATCGGATTCCAAGCT
CTTCTTTCTCTAACACGACGTTTTGTAGCGTATTTTGCATAGTTTTCACCGCCATCGCCGCTCTCTTGCTTTCTAGTGGATCGAACTCGAACTTCTCGTG
ATACTTGTTCACCAATTGTTGATGTTGCATCTCACTGCTAGTAGCTCTGGCTTCGAGCTTCTGGAGCTCCAACCGATGCATCTCGTCCATCCGCAATTTC
TCACTGCGTAAAAGTCGAATTTCCTGCTCCAGTTCTTCATATCGTGTGTCTTGTGGCTCCTGCAACTTACTTTGAGCTTTGATGAACGCATTTTCTTGCT
GTAGTCGCTGTGCATCTTCCCTCAATTGGTCATTTTCTTGCTGGACTTGAATGTACGAGTCATACAGAGACGTCACACATTGTGCCGACTTCCAATTCGT
TCCCAATTCCTCTTTTTCCCCCAATACTCCAGCTACATGTCGTTTCTCTCCTGGCATGAGCTCCAATCCGTTAGTGTAGCAACAACAGCTTCAACTTGCG
TCGTTTCACAACATGGCTACATATTATGTAGCCATGTAGATGATGGCCAATTTCTTCAGCTAGAGACTTGAGACTTTGTGATGAGATAGGGTAGAGAGAT
TATAAAGACTATCGTTTTTAGCGAGACTAGACCAACAATCGATACTCAGTGCGCTTTTTACCGAGCCCAGCACACTACACCCAAAGACCGAGGATGATGA
TTATCAGCGTTGCGATCGTGTTTGAGGTATCACCCGGATGACACGGCATTAATCTGTGCCCACTCATTGCTCTTAATAGTGCCATTTTACACGAGGATAA
TGAATCCAATGAAGCTGCGTTGACAAACGGACCGTTTGGCCTGCTCATGTTATTGCAAGTAATCGCAAATCATTTGTACAACGACGCCACCCGAATGCCT
GATCGATGATCTCGTTGCTCATGGCGCCACTGTAGACTGCAACTCGGTGAACATCAGCAGTGTGAATTCGGAAGCCTGAAGGAAGTACGCGTGTTGGGTT
GCTGAGCAAAGCGATTCTCATTTGTGGCAGCCACAAACTGTCATGTAAAATTGGAAGACGAGGTGAGGAGTATCTATCGTCGACTTCCATTGAAATGGAA
TTCCGGAA