Description :
From Genome Similarity Track
Location :
contig_54:21033- 24271
Transcript NameFunction/comments
g9123.t1hypothetical protein
g9124.t1hypothetical protein

Sequence
3238 bases(100 bases per row)
CGCGGCAGTGGCCACTGTCGCGTGACGCAATACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGT
CGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGGGCGAGTCTCAGCCTTGCTCATTGAAGCGTTCCTTCTTCGATTT
CGCGCTGAGGGCGTCCGCGCCCTCAGCGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATG
CGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATCCAGCCTCATCTTCT
TGTATTGGAGACCAATACTCGTACGCGTCAAAACACTCAGTGTCTCGGCGGTTGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTC
GGTCCCTGACCGAGACTTGCGCAGCTTTTCTTGCTTGCGCCGTTCACTTCTCGTTCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTG
GACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGACCGGCTTGATCGCGCATCACTTCGTCGTGCAGCCCGGCTGCAC
GCGAGCTCGCAAGCATTTCCGGTGAGGAACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTTCTTTACCTCTACGCCT
AACGGCGGAGTGTCTTTCGACAAATTGTGTGCCGACATTATCTGTCGACACGACCGCGTCGCCCCGGACGCTTCGAGACCTCTCGAATCCGATTGAATCA
GGCCCTGCTGATTCGTTTCACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTCGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTGG
TGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCGAAGCGCACGATCGTGCGCTTCG
TCCAGTCGATCACCGGATCATGTCGTGCAAGCCGCGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTTGAGGACGATAAGCTCGTCGACGAACTC
CTTCTCTTGATACGAGAAGCGTACGCGGACGATACGCTCCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTC
ACCTCCTCGAAGGCAAGCCTTGGAAGGCTCTGCAGTCGAGCAAAGTTGTTCGACGCACCACAGTCCACTAGTTTAGCTAGGTTCTGCGTAGCTAACAGAA
CTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCGTTCAGCCTTTGCCGATCGACAGAAGCTGCTGTTGCGTCCTGGACAAA
CCGAATTACAGCTTGTCGGCGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCG
TGTTGTTCGTTGTCGTTTGAAGTGTCGTAGACACTGTTTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGT
ATCAGCGTGCTTATACGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTC
AAGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGGTGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAGCG
AGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGT
CCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGAGAGTACTCGGATACTCTCGGAAGAGATAGGCCTTC
ACAGGCCCATCTCTAAGGCCTTTCATGAACGTGACGACCATTGTCGCCTCGTCAATCGTGTTGGTCACGATGTTCGAGGCCAAGTACCGTGCCCCTTGGG
CGTAAGTATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCTCTTGATCGGAACTCGTTCTGCGGGGGCTCAAACGCAAGTTTGAGCTTCTC
CTTGAACTCTTCGTACGTGCTGAAGCACGTAGGGTCCGTGAGTCGGCGTCCATACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCA
ACCTTCGACAACGGGTCGACGTATCGTCGACCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCCCCCTCTCTTCCAACGTAGCTGC
TTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGC
AACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACGCCGCTTCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTC
CGACAGGTGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTT
CGTATTCCATACGAACGTGTTAGTCAGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGT
GCGCACGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTTAGTATACTTGTATCCGCAAGTATACTGAAACCTAGATAAAGGAACCGAACGATAGCT
TTGATGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGTTGGCAGAACCCC
TACCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGAGTGGTCACCTGAA
TGTATCCCTTAGTGCATGTTGCACTAAGGTAGGAGGTG