Description :
From Genome Similarity Track
Location :
Scaffold_4:210324- 220334
Transcript NameFunction/comments
Phyca_LT1534532120unnamed protein product
Phyca_LT1534100034Hypothetical protein
Phyca_LT1534539851bromodomain containing protein
Phyca_LT15344959Hypothetical protein
Phyca_LT1534503529AlNc14C85G5459
Phyca_LT153499727sigma-54 dependent trancsriptional regulator

Sequence
10010 bases(100 bases per row)
tgacgacgcgcgcgtactcacggcgatttacgtggtggccgtttctttgatagcaaagtcccaaacggaacgcttcattcctccggcctcaaagctacca
gtgaaccccatgggagcccgcaaccaacggctgcaagtcagaagtcgtatattactaccagcgcggctgaggtggggactggaatgccagctcacctggc
aaccaaccaaccagcctggtgggcaggaacgaaagttgcgcaaggttttcatcgatgtacagtagtctgtcgtcctcaagccatcggctgccgcctggtg
tggacgttcacagcgtcgattggtggcccaacgtcgtctgttaactgtgtgcacctttgaaccttctccagcttaacccatttggtatcccatgcgtttt
tcgcttgggaactcgttggcgtacagttatctaccagcagcagtcaaccagcagtcaaaggtgcaattcaagccttgacttgagcccaagcaaccacgtt
tctctgaagcggtacagtgtgtaacgtgcaagttgtcggcaacttgtgtcaccgagacccacgtgcaaagcatcgacggctgtccagctctgctggtttc
tgatcggtcaagtgctgggcccaacaccctctgtcccgctcctgcttatcccagtcgtcgactcatcctgtcagcgtggcattcgccaatttgcactcct
gtccacgcgtcgttgtcaacttccaattagcaatgcccgatctccgccttgaagacttggccattgaccagcggcaattcgttgagcgtcatgtcaacgc
ctcgttcgcgcaccactccgtgtcctttgacgaatcgcttagccgttcacaccacaagtcacagcggactcgcaactcgatgcctgcagcagtgcagcga
acgtcgtcggacctcggattctcgcgcctctcgagcttcggcttcatccctggccacgaggtcctcgaaactagcgtccggttcttgggcgtctcccgct
tgcacaatcactgctccttcaagctgcacgtggatactggcaaggaacaattcgtgctgcagaagcgctactcgcagttccgcgatttaaggaagcaatt
gctgctagacagtaagatttcagacacttcgactggaaagggacgcgcgggtgactgccgtaatggagcgtgcgccgccttggttcaacagctcgcagac
ctcaagtttccgcgacgtaagatgaagttcaagatgcacaaggacgatgacatccggaccgcaagggaacgacaggctcaactccagcactttgtcgacg
ctatcttggcagtgtatcgcacggcaccaaagcgtaaggtgcgtcgctgtgtcaactcgcagtgtcgcgtgcttatagggatccgagccttcttggatat
caaggatctagacgaagacgagctgtcggactggaaatcgatcagcaatggcacaaccagtggagaggaagtgcctatccttgatactccaccgtcgacg
tcttcaaacccgtcgcttctcagtaaggcagtgaacgatactggttcaacggagtcgtctattgaacgaaagacgtcggcaatgtgccttgaagacctct
acacaatcagcgaggacctggaaaacctccacgtctagacgatgtggtacggcgtacggacgattgctagtctctacgtctccgatagcaaccagccaat
gtagtaacttattttactcgcgttgcagttaagtactatagtccaagccccgctccatcaaagactaaggaagatgcagcaaactaaattaaacaatcgc
atttaatctctcaaagtgctagtgctcaagacccttttgccttgaacatctccacaatgacattcgaaactttgtcctcgtcgttgcgtagccctcccat
gatctgtgaagctttgccccactggacgttgctaccaagcgcctgcataacagtcacgcgttacgttaagcgaattctataaagttaccactgggttcac
cagttacctgctcacgcttgttctcagcgctatccgggcttgaattgtcgtttccagctcgctgtcgggcccactgcgttataccagaaactgacaaagt
tagccgttcaattacaaatgagcccgcctcatgaggagcttacactgacccaactgccatcatttccacgagatcgacgtggagatggcttggaattgtc
aagtaggggcttcttcgctcgacggagttggccagaagagacacctggaactccgtggtcagtttgggaaccctgagcagctctaggtgaagtcggtagc
tttggtaagcaaaactctggctcacgtgatcgatagccaccgagatctggccgaggtcccatgatgggaatgtgttcttcttcgtgcctagtgagcaccg
aggccaccaaatcgtgtttgtactcgttccatttcatttcacgcttcaagtcccgtataacgttcctagtgtcggcgcgagctgaaattccaataacttc
ctggcgcagtatttgctccgtggtcgcgtctttcagtataagttgtcggaaatctacacgatcaacgcgatacagcacagcagtaggcgacgaaatcagt
acggaatatacggcgttggtcacacctaggatagcttcgtagaaaccgaagtagtgctgactttttataatacagtgaacgctgttagaactgttaactg
tacgacatcaacactccttttacctgcaaatggtggccatttcaacgaagcaaggcttgcggttgtgttgaggtgttctctgctcgaggaccgaatagcg
cttgaccattctacactcgccttgcttaacgaagtagaaatgatctgaacacaagttaaaatactgcagatcgaacagaaacaacatgcatcatgacgta
cttgcaggttcgccttcgacaacgataacatcgttataagtgtgttggatcttctccattcgatcgcacagttttaggataccttcgtcttcccaatgat
ccaagcatgccacacctgctaggaatgtcattttctcactgcaattcaacacaactacgatgaacgagcaatacaggatcattgattctcagaaatcaat
acgcaccggagttcacgtgacagattgcacgcacgtagcgccatgaacgtatctcgatcaatttgcatgagcagggtcgtctctgtggccacaactgaag
ctgtacgttgctgttcttcaagaagcaaacccacgtctccaaagacctccagcggcttcatggtccgaacgacgtaagtagcatcgtgcgacatatccag
tttcccgcctggattcaggaagctcgagtgcacacgtgcacgattcatgatctcctcaaattcgttcagagtaggggctgccatgcgtgagaaatccatc
accacactcattgttccatacatgatgcagtagaaggcatctgcgcggtcgccaattcggaacagagcgtctccatcgtcaagctcgatgcctttggccg
cttttaagaagcgcattcggtctctgggcggtaggtcgcgaaagtatttgacacgttggactagagcaagcagtcaattcaattgagcatcaagtggagt
gcagtaagcttgagtactattctagtagaactcactgtatttgtcaagaaactcgtaatcagctttgcatcttgccacctcggacaactgcaagatccgt
ctcaaattggcctgcacttccgggaggtcatggttcagctggtcctgccaattcgctctcttcgatagcctgacaagaaccaatgcagtgaattagcgct
tcaaaacttacccattgcatgtagacgtacatgcttcaagtcttgtttttccaagttaccatttctaaaattagaaatggctacagtttattgttttgtg
tgtaccacgtaccctttcagagttgatacgctcactcccatacaaagcacaaagcacgaaaggtgaggatgcatctccttcctcttgagcttgtacgtgc
gctccccccagcgctcgttcgcttgagtaaccgcgtgaattacgtagttctttatctcacctacccgtccataccatttatgtgtagattcacgccctct
atcgtcgccaattatccatttagagagcctcaatggaccccgagaacaggaaaaagtgtattgacgtcgcggatcatttcttcaagctcgacagttgcgg
tgggtaaatatttgctgaaaaataaactggtggtgatatgctaatactcattttgtgaactgtagagccgttccgcgagcgtgtcaactgggaggaatgg
ggactgtacgactatctgcaggtggtcaaggagcccatggacttaggcacgatccgcaacaaactgagcaagaacgagtacaagaaaccggtggagtttg
cgcgtgacatgcgtctggtctggagtaactgcaagctttacaaccaggacggttccgatctgtatctgctggcagacgaactcgcgaagaagtttgagga
ccgcgttaagaccatgaagctcgatgtaggtccggtacccaaagctgacaagagtattccgtacggtgcacgattgaagagctgcagtatgataattagt
tgttttctaactttaagtttttgtgctgctttgatagagctccaagccttgaagagaagatccacttcagccagaacatttacaaggttgaccctaaaga
cctgggcacgatcgtacagcttcttgaggagcaatgtcctaagtcgctcgacaaaagctcaccagacgaactggacattgtcgtcgaccacattgacaat
aagacgttccgtgacctggagaaatttgtgctggaaaaagtgccagagggtagtcgcgagccgatttcgacgcctaaatcctccaaaaagtcccgacggc
ctccgagcaagaagaccaaaacggatgtgtgattgatggtggacaaacaaggttagtattgacatgcgttcacgagacaacgcagaacttcgacctcaag
ttttgacggttcgttagggcatttgtttaccgcgtaacctcttacactttgcttcatttgttagtagtttgaccttcaacgatatctacttcttctttcg
aagcatagctgctagtcgcgtctgccgttggaaagtggcctcgaagctttttctcttttgcttctttacaggttcgtccggttcttcggtaggagatacg
ccaagtgttggccctcctggtaatcgactgaagtctagtggcggtacaaccatcttttgtggtgatacaacaggttcatctgggcgggctgcaggaactg
ccgctaacagctgagaccccgccttggcgcgagtggactgccactgaggtggtatggaccttggttcattattagtttccgctttcgcaccgccgccacg
gtaggctttctgtagcggagctactggttgcagcttcaacactggcaggttaaactttgatgggcgtcgaacagctttacgttcaagagaaactgaaggt
ctgcgagttgattctggtcgattttgaagtgatcgcttgtactcgagcagctcctccttgtgcagctccatcagctccctaatggttatcaacacgtggg
tgagatcatcggtaacctcgaacgagagttatttcacttacccgagtgaaggttcatccccgctggaggcattccatttgtcaccatggagtttcttgcc
tgctttcatgagctttttccactcctcttcatcccggcgactcgtttccacccgagaggttacgatctcttcaagttcatcgtggtaacgtagctgatct
tcacgagcggcaagttgatcttttagcttgccaatgtatcgcctcaggtcctcttttctctttccaatctgctccagcacgcctgtgcttgactgttgaa
cttgtagcggagggtgataccctacaacgtagaagagtcaaactatcacctagaaatgcagttcacctagtagtataatacgtacttgctctcctctgtc
gcttttgcatgtgctgctgaaggaagcctaagatgagcagcccagccaacacacagccgatgattaaacctggcatattgatcgtcgtccccgctgtccc
tcgaatatttggcatgttgtttattcaaccacgatcctgttgtttctttaaaaaaaaaggagaaggacatctattcatcttcgtgaagatgcatacctta
tttttaggccggagtttgcagcatcagaacaccatcttaaagcgaagttctacatgtacctttctttcagtgcaaccccctccagtcattcattgaccag
cgaaacagacagatatctaccaagcgtagttcgggaggcaagcgcatttatttgccttgtgcttcctaaatttgtacaaaataaataggaatgggtagtg
cctcacacgtctgcaacgaacacatcttcatccacagtgaaggtagaagcatcgaaactcaagtttgacggttgctccgtcggcatgggtgcgacccagt
agtcactgaagtccaggttgtcccagctctctccgacgtccacgggggacgtcttgccctcaggtaatgaggctagtgcctccattcccgaaatcgattc
caagctcttgcacaccgcggcggcatcgtcctgtaagatccgattcagagcttcctcatccacagtttcagggagacgttgcatctcaatgggaatcgtc
tgcaacgatggagcaggggccaatggttgttcctccttaatctgaaatccgttccggtcgtagacgccgtctagcagcaccagatcctgaaggaaccagc
tggtgagacccgtggaagtggctgtagctgcagccgcgttgttcctgctgatctctttggcctgctgcttagcacgcagctcctccttcatggctaaatg
ggcgctgagtggagcgcgacgtgctcgctgacggggctttttgtgcgcgcgcagtctctttccggaaggctccgcgtctgtagacgcctgtgcgcgcgcc
ttgcgcttaagttcgaggcgacgttggttcttgttggccttttggcggtggaagtcgcagagattatgaagctcgccattgcgtttaagcgcgcgcgtgt
tccagcactttttgctcgggtagcggcacatgctctccgggttgtgcacgggctgttcctgtgcactagcagaactctcagacgtaggggacgtgggggt
agtgggggcgccaactcgtgtggccatcatgtcgagcagtgcggcgaacgggaggcaaatgcgcgaatggccggactcgtcgagtcacggaagataccgg
cgcctgcctgcgcaaatcggatcggatggctacatgggtgaatttgatgagcagatggaagcgcataaatgggatctcagttcaatagtgaaaccaagtg
aacgccagtcgagtgtggattttggcttgaatttcgagggatggctcagaaaatccgagtgggcaattcaagtgaagtgactgccggtgccacctccttc
tcgtgcctggagccccatagagtctatgatagacggcagggcggagcaccggccggtgctgtcggtgcgtctctgctcggatgactggattcgagcggga
gagtcacgtgcgtggttactaaagttgtgcaagcaaaatgtgacagaaattgctggcagtgatcaaaggaagctgcgtcgtcgggtaaaccaagccatgc
ctcacatttatgcctgactatggacgcacacgtgcggcgtgttgatgcccgaagtccacccacggacgaggcactcgaatccactcggcccaaattgtca
ctggtcatcgcaagcagcgaaaatatcttgccacttcaacttgtattatcaagttttgctgcagtgtagtcagctagtggtggatatttagttcacgcgc
gacgctaagcacgaagcatgcgggcgacaatttggctttgatcacacacatcacgatgcagcaagacatgagtggcacaataccactgattacaatgagc
aaaaccaacgatacatgttacgtttcttttggtatggattgaaactggtctcttccgcgatggaaaaactattcactttatgactttaggtactttgcta
cttctttacttacgggaacgattctggcttaaatgttggcacgagtggcaagtgagggtcctcgccgtgtgtcctgccatgaactttgcaatccttctcc
cgatcgcgctacagcagtggcaatcggtggcagcactctggatggcggcgactgaacggaagtagcctctaccttgggcggggtaagtggggcacggtgc
atccacccattggcgtcaaaattgggctccatcttggccattgccgcagcacgaagcattgcacgagggcttctcgggtacggcgcatgcacccaagcag
atagtggaagccggttggactccacttcattgctgtacactggtgcgttgcccattgccacgagtcctgccgctcgctgcagctctacgagtgaaggtgt
ggatcgcggggcacggatgtactgcgtggtcaatggcatggagcctaattcttgctcgagcttgagctggatggaatcgcgcatgcgcatacgacgcgcc
aggtccgagaacccgttgacgcccgcgtgcaatggcaggtggttgcccaagcccaatgcctgaccagctttgcgcttcttgtccagacgacgctggttgc
tgttggctttctggcggtgcatctcgcacaggttgtgacgctcaccgttgcgtttgatggcgcgcagattccagcagcgtttgctggcgtagcggcactt
gagcgagctgaactcgtcgtccgtggtctgttgcatatttggctctagtaatgaagagaagagagagtggcttatccggaagaggatgaattgaagagtg
agtggtttgctacggcttacgcttcaaggtggagaatcttagcctgaactgagatgtcgactttcgcggtttgacgtgacttagctgaggcagcagattt
ttgtcatccttacatatttcaagattggtgtcgactttaaggagaggaggcacctgagtttgtcgacttaatgaagaggaatgtcgctttttggtggaga
gggggcgttggtgctgatttatggtcggagtattcagtctcgccttcgctggtttgcgagctgctccggaccgatatgagaaggtctacagtaaagctca
atgctgccagatcgtcatgggactgggatgtgtggcgctgattcgagcccggacagcctactacgaaagacactgtggcataccaagatggccaacacgt
aacccagaaccgttttgtcgttcctgatttttgtagtgcgaatcagttccgctaccactttcagcgaattcttgacgactgaagcaatttggtgcccgaa
cgattgtgtagcgaacgtttggggggcctgcgagcaaaatcctcgcgtctcgcaatggtcgagactcgtctgtgactttcagccgaagctgctgtgagag
cgcgacgaaaactgaactgcagaagatctcggtgctccgagcggtcgagagaataagctcagacctgggagatatctttgacaggaatcagtgggttgcc
aatgactgtagtgcgacggtctccatgtgcctcgcatgtgtctatactgtcgtcagcgcagcaagttcgtcgagtctttcctcgcacttaattgatgaag
ctctatcgcgctgactcatgggtgggtatggtggaaagacggcaagaacgttgaagttatagtcggtcgctgtcaccttggtgatctcggacaagttgag
ctccatccctgaactcaacagccgatacacatgccagatcagctactgtatcttgtggttcgtacggcgggctgtaacatgttagcaacttagtgtgttg
ttgagaagccaagtatgtctaacgcactcgtccatagttgcaagacgaagccggaagccggcatggtgtctagattgtagtcgtatctcgtcaagtcggc
gacaattatc