Description :
From Genome Similarity Track
Location :
Scaffold_8:2102545- 2104998
Transcript NameFunction/comments
Physo_339430Eukaryotic/viral aspartic protease, active site

Sequence
2453 bases(100 bases per row)
CGAGTCCGGATCTCGGCGGTCTCGGATCTGAAGGAGTTCTCTGGCAAGGACCAAGACGAGGATTGAGTGAGAGCTTGGGTCAGTAAGGTGAAGTCTGCGT
TCCTCCGCGATCAAGCACCTGACGAAGAGAAGTGCCTGACCTTTGCGGATCTGCTGTCTGGATCGGCGCGGAACTGGTACCGTCAACTACCTCGATCCAC
ACGCAATAAGTGGCCGGATCTCCTTCGCAGCTTCCAGACCCAATACTGTGGACTGGGGATCTCCGTCGCCCGCCAGTATTATCATGCTCGCAAGCGATCG
GATGAGTCTCCGCTGAATTATCTCTACCGACTTAACGTCGCCGGACTCCGTGCTCGACTCAAGATCAAAGACGGTGGGTCCAAGGAGAAGCGCGAGCATG
TGGACCATTTCATTGAGACTCTGGGCGATGAGGATCTGGCGGATCGGCTGGCATTGCTCCGACAGCCGGATGCTGACGAGTTGGAAGAAGTCCTGCGTGC
CTTGGATCGGGCGAAGAACCGACAGAAGAAGTCCGCGTATGGATCCAGCAAGTACCGACAAAAAGCACCAGCGACGCCTGCGCCGGCCGCTCCAGCCAAA
CATGTGCGTGCGATCCAAATCCAACCTGACTCGGGATCCGAGTCTGGATCCAGCGATGGATCGGACTCCGAGTGCGACGAATACCGCAGGATCTATTTGT
CTGCCTCCCACGACCATGCGAAACCAGTCGAGGAAGAGCCGAAAGCCCTGGAACGGAACCCTCTAGACCGGCAGCAGCAAGATCCAACCTCCCGCGATCA
GAGATCCAAGATCCACGCTGACGGATCCGAGAGAAGCCGCTGTACGCACTGCGGATCCAAGAAGCACTCGCATCTCGGCTGCTGGAAGCGGTTGACGTGT
GAGAAGTGCGGCAAGAAGGGTCATCCAGGTGACCATTGCCTCTTCGTGTGCCGTGGGTGTGGTGAACTCCATGACGTGGGCCGGTGCCCGATGGAAGAGT
TTTACAACCAGATCCGTCAGTGGTTCAATCCAGCCAAGCATGCGGGGATGCTGCCAGAAATGGCGGAAAGGATGTTAAACTAGGACGCTCGCCGGGTTGG
AATCCGGTACGAGCCGAGCGTTCTAGTTATTGCATCTATGCATTTGTGAACAAGACATCGACAGATCCAGTTAGCAAACGACAGAATCTACGCGGTAATA
CATGTGATCTTCATGGGAAACGTACTGCTGTGATCTCAAGTCTTCGGCAAGCCGACGACTACTCCAGATCCGATGCGACAGTGGAAGCAGACCTGGATCC
AGAAGCTCGTCAAGGCTATTGGAAGCAGCAGGATCCAGAGCAGTGGTTCAAACCAGCGGAAGGCGAAGACACCTCGGGATCCAGATCCCGACGTGTCGCT
GCAAGCCGGCGGATCGTAGATCCAGAGTCCTCGTATCTCCTACCTGGAGAATTTCGAGGGTACTGGAAGCAACATTCGCCAGGCAAGTGGTTCCGTCAGG
CCAAGATCCACGGCAAGATCAACAATGAGAAGGCTATCTTACTCCTAGATACCGGTGGCGAGGTGTCCATCGCGGACACCGCCTTTGCTCGTAAGGTTGG
GTGCTACATCGACAGGAGTCAGGGCCAAGAATGCGTTGGGATCGGAGACAACGTGTATACGACGGAAGGGAGAACGCGGATCAAGATCACCTTGGGTCAG
CCGGGATCCGACTGGATCTAGCTGATGGGACTCTCTACCTGCCTGACGAAGTCCGGATCCAGCTCAGCGGACGCTGTTCACTCTACAGTGACAAAGCGCA
GTCGGTAAAGTTGGATCGCTATCTCCAGCTTGGGATCGGAGAGTCCGCAGAGTTGCCCATGCGTCTGCGAGGATCGGAACATGACAAGCTTTGGGTTACG
CGAGGGGAGCGATGGGTGCCAACAGTGATCAAGGGCCCGGGCAAGACACGGTACCTTCGAATCACGAACGTCGGCGATAAGGAGCTGGTGCTGCGCCAGA
ATCATCAAGTAGGGATGTGGCTGGCCGGTGATCGGGTGCCGCGGATCCAAGGTTACGTATCCGTCGGATCCCGCCGCTACCTGGAGTGGCAGAATCTCGT
GCTGCAAGCCACGACGGAGGCTGGATCTGCGGAGGTGACGCCTCCAGAAACCCCGACGGGGCCGATGGTGGAGCGTCCTGAGTATCCGACGCCGCGTGCA
ATACTGCGGAGGCAGGATCCAGCTCAAGTCAGACAGGTGGAACCAAGATCCAAGAGCGCCGGGGGTGGACGGGGCAAGTCGCTGCCAGATCCGCCCGGTC
AGGCGATCGACGAATGCATCGCCGGGGCGGCGGAGGTGTTGCAACTCCAAGCTTCAATCAAGGCGCGGACACGAGATCAGCGACCGGAGGAGACGAGCGG
ACAAGTGATCCGCAGGCCGAAGATTCGCCGGATCAAGATCCAAGTGACGAGGA