Description :
From Genome Similarity Track
Location :
Scaffold_107:210241- 212563
Transcript NameFunction/comments
Physo_142053hypothetical protein
Physo_142054reverse transcriptase

Sequence
2322 bases(100 bases per row)
ACTGAAGGAGTTCACCACGCTTCGCAAAAAGCCGGAGGACAAGGGTGGACTCCATCCTGTGTGGGGTTTCCACCGGGTCAAGCCGAATGACAACATGACC
TGGAGCGAGGTGGAAGACCTCTTCTGGCGCTACGTCCAGCGCAAAAGGTATTCCGACCAAGAGTTCAAAGAACTCCGTGAGGATCGCACTCTGTCCGCAA
TCCTGGACGTGCGCGAGCTCCGCATCGAGTTCGCTCAACTCGTGAGCAAGCGCAAGCTCCACTCGAAAATGGACGAGCTGAAGCAAGAGGCGAGAGCCAA
AGCTCGTGAAGAGCGTGGGCGTGGTGCGACTACGTCTGCTACCGTGCCCCGGGTACCGGCCAAGAAGCCAAGGACTACTTACGAAGCTGCCGCTGCTTCT
CATCCCATATCGCAACAGCCTTCGGGCAGTCTGCCTGGAGCTGCTCAACGGGCTCCTGCGCGTTATCCGACTCAGGGTAACCCCTCCACTTCACGAGCAG
CTGTCGCTTGCCATGGAGCCGCCGCTCCCGGACGACTCGTTCCACGTGGTAGTGGATCTGCCCATTACGATCAAGGAGGGCCGGCGGTGGCCTCGCACGG
CCATGGCTACGAGCCTGAGGCGACGCAGCCGTATGCTGGGGCCCCGAGTCAGGTGGTGGCCCTGCAGCAAGAGGAGATTCGTCTTCTCCGGGACCGTGTG
TACGTCCTCGAGATCGCGCTTGGCGTCGGCCTTGGTGGCGAGGCTGCCGCTCGTGCTGGTCAGCCTGGTGCCGTGGAGCGGCTCCGTGAGGATGTTGCCT
CGCTCTATCAAGAAACTCGCAGTCTCCATGGCCGAGTGGATCGTCGAGCCGACCTGTCGTCTTACGACTCGCTGCGAACCAGCTCGCTGGCCTTCGGGCC
GAGCTTCATGGCCACGCGCCGTATCCGGAGCAGCAGCAGCCCCACTCGTATCAGGCCCAGTTTGGCCAGGGCTCGTTCGGGGCCCCTGCGTATGCTGCTC
CGATGTACGCCGCGCCGTCTTACGACCAGCGCGCGTATCAGGCGCCTTACCGCGACTCGACGCCGCGCTTCGAGGAGCTGCGCTCTTCTCCACCGGGCCA
CCCACCGCTTCCTGTGGGGTAGCCAGAGCCAGAGGGTCATGGTACCTCTTAAGACGACCCACGTAAAACGTCGGGTGAGTCGTCATCGACTTGGGCAAGT
CTATGGTGTACGCCGCGCCATGCCGGCTGAGGACCGTGAAGGGTCCAATGAAGCGGTGCTTCAGCTTGTTGCTCTCAACCGAGCTAACAGTGTTTAGTGG
TAGGTTTCTAGTATCTAGGAGAACTAAATCCCCAACCTTATACACGTTCATGTTTCCTCTTCCATTTCGGTCAGAATACTCCTTCTGTTTATCTTGGGCT
TGCGCCATGGTGTCTCGCACCCTGCTGATTATGTTCAGCCTGTCTTCGGCAAACGAGGACAGTTGCTTCCGCAAGGTGGCTGGACTCACGTCCGAGACTT
GGGAGGAAAAGGTTTTCCGAGCCTCTCCCCCACTTAGGACCGAAGCCCCGGTACTGCCTCGTAATGTGAGCGGCACCTGAGGGTGGTGCAACCCGTTCAG
GTAAAAGGGCGTAAGCCCGTCGATGCATGTACCGCATTGTTGAGTGCGAACTCAACCATGGGCAAGCGATCAGCCCAAGAGCGGGGCATCTCCGCGCAGA
TACTGTGGAGCGTGTCTTCGAGCACGCGATTGACGCGCTCCGTCTGGCCATCCGTCTGCGGGTGGTCCGCCGTCGACATCGACAGTCGTGTGCCGAGAAT
GCGAAACAGCGTCTGCCAGAACGTAGCGGTGAACCGCGGGTCTCGATCAGAGACAATGGTCTCGGGCAGACCGTGGTGTCGCAAGACACAGTCCATGAAC
AGGCGAGCGACCTCGTCGCCAGTGACGGTGTCACGAACTGGAGGAAAGTGGACCATCTTGCTCAGACGGCACACGAAGGCAACAACACCAGTGTTGCCAC
GGTCATCGGCCGGAAGTCCGAAGACAAAGTCGAGACTCATCGACTTCCAGCAGTCCGCTGGGACCGGCAGGCTCTGCAATGGTGCCGAGGCGTGACCGGC
AGGCTTCACGCGCTGGCACGTCTCGCACGTACGGACGTAGGTGGCGACCCACTTGTACATGTGACGCCACCAAAACATCTGCGAGACAGACGCGTACGTC
TTCTCACGGCCGAGATGGCCACAGGAAGGAGCGTCGTGCGCCTCCATCAGGATGTCGTACTTGAGATCCTCGTCGTTGGGCACGACAATACGGGGAGGAT
CCTCGGGCTCGGCCCTATAGTG