Description :
From Genome Similarity Track
Location :
Scaffold_2392:2102- 3864
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2392-snap-gene-0.2Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_2392-fgenesh-gene-0.1Zinc finger protein

Sequence
1762 bases(100 bases per row)
GGTCCGGGTACATCTACAAGAACCCAAACGAGATGAATCGGCTCTTTGGTGTTTCGCCCACCTTAGACAGCGACGGTACCCCCAAGCCCATGAGCTACGA
CCAGTACCACGTGCTGTGCATGCGCAACTTGCTGTTCAACATCTCGCATCTCCACTTTAGCGCCTTCTTTGTGCTTCTGCTCATCGCCGTCGTGCCCGTC
CTGTTCCCTCACTACGATCATTGGATCTTCCTGGGCGTCGGCGCGATGCTACTGTTCGTGAACGTCGTGATATTCTTGAAAGTGCTCAAGATCCTGCGCG
GTATTGTGGACGACCGGCTTCGAGTAATTTCAAGCAGTGACATTCGCCGCCGCATGCCTCGCCCAAGCCTCAATCCCAATAGGGTAGACGACGGAAAGAA
AAAGCCTCCGAGTCTTCGCGTCGTCGCGCTCGGTGTGCGCGCCGTGATCCGCATGCAAATGTCGTCGCTGTGCCACCACCAGCTCCACTTCCACAACGAC
CGCTTCTGGTTCAACAGCCCGCGGTTCCTGCTTCGCATGTTCCACTTCGCCACGATCGGCCAGGCGTTCTACCTTGTGTGGTTCACGCTTGTGGAATGGC
AGACCGTCGCCAGCACTTCCTCAGCGTACTACTTGATCCCGATCATGGTACTCCTGCCCTTCGTGGCCATGTGTGTGATCACGCCCATGACGATCCCAAG
CCTCGTGCTTGTGATGAGTCTGACCGGCATCTTTGTCGAGCTCAATGGAGGCGATCCTACCTCGGGCCAGCGCCCTACGCAGCGAGAAACCAAGACCCAC
ATTCGGCTCTTGCGACGCTCGTACCTAAAAAGCCATTACACGGACACCGACGAGCCGGCGTCGCCGATGTTGCCCTCCGAGTTTGACCAGCCCATGGCGG
AAGGTGCGAAGTCACCCGCGTCAGTATTCCTTCGCATTTACGACTCTCCAAAGGCAGCCGCGCAGCACGCCAAGTCGGTGGCGAGTTCCAGCCCACGGCG
CTCGAACGCGCTTCGTCACACCGATGGTCCACTTATCATGAGGAAGAGCGCGAGCAGCACTGCGCTGGACCAAAGCGCGGGAGTGAGCGATGATCTACGG
GAGCAGGGTCGAACGAGATGGTCGTTCGATTTGGGGAGCGTCAATCACGATGCCCACCGTGACCCCAGTGTCGACTTAGATCACCAAGCACATACCGAGC
CTGCGTGGACTTCAACGCCGCCGATCTCGCCTGCCTTCAAGAACTACTGCTCGAAATACGGCGGATACCCGGATGCGTGAGCGAAATGACGACGACAACA
ACAACCATACATAGAATACATAGAGTAGATCACCGACTTGAAATTAGTGCATAAGTCGAGACACGTAAGAGAGCGTATTGATGTGTTTTAGCACCCACTA
GTTCGATGCGCGCACAGCCGACTCCAAGGGCTTGTAGCCATATTTGGGTCGAAGCGCTCGCTTCTCCTCCTACCAGAGAGATCATGGCCATGGTCAGACA
CGAGTGGAGGAATAAATCGGTGGACTACACAACTATTCACCATTGAGACGTCCTCGTCGTAATACACCATGCCGTCTGGCTTCGGTGGTCCCGTTGGCTC
ATCAACTGGAGTCGATGATTCATGAGCACTTGGGATTCCAGCAGCAGGAGCTGCCGGCGCATGCATCGGGGGAGGAAATCCTGGGCGTGGGAACCCTGGA
AACCCAACAGGGGGTGCAACCGGTGGGAACCCTGGAGCTCCTGGAACTGGCATTCCACCAGC