Description :
From Genome Similarity Track
Location :
Scaffold_260:2102- 3390
Transcript NameFunction/comments
Phyag_g4044hypothetical protein PHYSODRAFT_475220

Sequence
1288 bases(100 bases per row)
tAACTCATTAGAACTCTGGTATTCAAGTAAGCTGGCAAACATGCAGGCAGAATGACGAATAGAAGTGACGGGTGGTGCTAACCTCATTGATAATGTGTTT
CGAGTTCGATGCAACGGCGAGTGCGGTTGTGTAACCCCAAATCCGCAGATGCCATACCTATGGAAAAAAACTCCGcggctgctccagcgactttGCTCTT
GCAGTCtgcgtggacgacgatgagcaCAGTGGACAATTCCAGTCTTTTAACACTCAGTGTCTCGTTCCTGGGGCGTACTGTTCTTGCCCACCAGCATCAT
CAACATTTGCATGAACTGCTCGTGTCTGCGGCGGTTTTCAGCGCGCTCTTCGGCGCGCTCCTCatcacggcggcggcgttcctcacgctcttcatcacgt
cgacgatcttcttcaaGTCTCCGCtgctcaacttcttctcgccgtcTTAgccgctcttcttcacgtcttgttttctcttcttctctatCCAAGTCTCGTT
GATATTGGGACCGTAGTACGACTTTTAGCACGGATGTAAGTAAGTCGTCCGTTGGAAGAGGCGTAGCTTCCGGCGGGAAAATAGCTGCCGGGCTCTGCCA
CTCGGGCGTCTGACGCCCCGCTCGCACGCgcggacgagaagcagcaggaggaggcgtcGGAGTCGCCAGAGGCACAGCTCCAGCCTCCGTGGTGATCGCG
GTCGTGCCAGCCGGGGGAATCTCCGACGCCGTGTCCACCCAACTGTGCTCCGACTCGGTGGCTCCGTCCTGCACGCGCTCGTCGCCGGGGGGCGACTGGA
ACGAGGCTTCGCTAgcgtccaccgccgtctCCCCATCCAGACTCGATACTCCAACTCCAGGCGCTATCGGGACCCCCTCGACCATCTCCTTATGCACCAT
ATGGGCGAAGGTGATGGCCTGGTGGTTCTTGGCTCCGCGCGCAGGAATGTTGGCCCGATACAGACGGGAGAATTTTTTCTTGAGCGAATCGGCAGAGCGA
TTATGCTTGGCGAATTGCTGGTTGTGCATTTGCGCGATCACGTCCCAGCCCTCgcgccagcgactgcgcaCGACTTGGAGTAGCCCCATAGACTCAGCCT
CAGTGAAGCCATCGCCGCGCCGCTGGACGTGCGGCCCTAGACGGACGCGCTTTACCTCGGTCTCATAGCTTTCAGCCATTTTGGTCCTCAGCAGGGGGAA
TTTGCGAATGGGTGGAGCAAATTTTGAGCAAATTTTGAGCGAATTTGAAGCTATCATTTGGATACATTGCGTTTTTCAGCGCCAACAT