Description :
From Genome Similarity Track
Location :
Scaffold_661:21017- 23662
Transcript NameFunction/comments
Phyta_totarag10016hypothetical protein PHYSODRAFT_350945

Sequence
2645 bases(100 bases per row)
aggctgctgcttcagtgCACTTTCAAAATAGTCCCTCGACGACATTTTCTTCCCGTCCTCTTCCAACTGAAGAGTGAAATCCCTCACAACCCACAGAAAA
GCAGGAAAAAACATGGACAGTTCACTgccctcctccttgttctCCTCTTCGGGATGAGCCTTGGCTTGGATGTACTTGGTCAAGTTCACCACAAGTGACA
AGTCCTCAATTGCATTGGCATCGATTACCCCTCGACTGTTGTAGATGAACATGGAGGATAACAGCAAAGCCAGGGCGAATATCCGCGTGTCTTGGGTTTG
GGAACGTTGGGTGGAGCCCAGCCCCTCGGTGTCCATGAAGACGATCGTTGTGTCTTTACTAAGGTGTTTAAAGGCCGGGTGGAGATTCTGATTGGCTGCC
GGTTGGCCCCAGATCCAAATGCCCTTGGTACAGGCATTGACTGTAGCTCCGACGTCGAACATTTCGCTCTCTTGGTCGCGtccgagcagcaggttcaaAA
GGTACGACTTGCCCGTGCGGTAGAGACCGGcgatggccacgacggcgatgTCTCCgcggatctgctgcaggTACGCGACGGCTTCAGGTGATATCTCGAA
GCTGCCATCGTCGGAGAGCGTCACGAAGGGAAGAGGAGCCaacagcgctgctggagaggaCGTGGGCTCCATGAGTGCAAAGGGAAACTAAGGAATGATG
GTCTGTGACTAGCATGCTGGAAGGGAGTTCGGAAATATGATCGAATATAGGTAAATTAGGTTGATTAGTTGCGTTggtttttcttttttttacAAGACAG
CACCATGTCTGTTTCTTTAGATACTGTTCGCCTTCGGCTAATTTTGTAAATTACGTGAAGAAAAACACATCACTTAAATCCTCAGCTACAATtgttttct
accaattaGATTGCTAAACGATAAAATTTGGTCAATCCTCGACTCAAAAGTGCGCTCAAAGCTCCTCTTTTGTGTACCATTGATACCTCTTTTTTTTGCG
TAACTTATGCTCACTCTTTTGCAATCTGTGAATCATACCATAGTAAAACTAAGTGATAAAACTTGTAAATAGGTTTGGGAACACGGAAAAAGTTGAGCAT
ACCATATTTCGCTTGCAGAGAGATACACCCCATTCTGAACCAATCATCACTCAGAAAGACAAACCAAGAAATCACATATTGAGAGAAACATGTCATTATT
CCAAAATATTGTCTATCAGTTGTGAATGGCTTGCGTGAAGCCACAGGGCTGCCCGCGCGGCAGGGGTATCGGACGGTACGTCTAGCAGTGTAATCTCTGT
GCAGATCCTGttgagaagcagctcgtggtaTATATTTCCTCGACAATAACACAGTCTAGCATGACAGGCACCAAGTCAAGTATCCGGACAGGGTTGAAAT
GTGCAGCTGGATCCTACAGTCCAGGGAGTCGCTGTCTGCTGATATGATTTCCCGTGGATTACACGCCAACAACCTGCAGCCAAGTGCTAGGTGTATCTGT
AATAGTGTTTTGATCACTGGTTTAGAGAGAACTTGTAGGCGAATGCCGTTGCCAGGATAACAACGGTGAGCAGGCGATTGTTTATATTTAATTAAAAATT
TAAAAATCTCTGGATACATCAGTTTTGTGAGGGTACCTACCCCTAATACTTCGGATGTATCTCTCTAAATGCGAAATACGGTATCTAAAGTTTTGGAACG
GACTGataccgacttcctcggcttataaTAGACAGGGCCCGgtccggtacagtgtaccattCACAATCCGATTTTGGTTACCAGTATCGATATCAATGAT
AGTCGAATGATGGTTGAGCGTCGCTAGCGTCTAGCAATAAATATCTCGCCCCCTACTCGCTTCGTACTCCCTCAGGGCGGAGAGGCGCTTCCAATGTCAt
taaccccgttacaccatCCCCCCGTTAAGCTAAGACGTGTCAGTACCGGCACGTCAATACTTCGGAAAGACCCGATCTCATTTCGCAATTAGATCATCAC
CCGCCACGCCGACGCCCTCGACGCCACGCGCCATGACAGAGGGTAACCTCTTTGTCTCTGGGTATCACGCTCTgtgaagcagaagcgtggtGATACCTCT
GGGGCAGACAAGTTAAAGTCTGTCCGTGCCGAAtcctcagcagcctccgGTGACGGAGACTGTGATATTCCTGTGAACTATGAGCTTAGTTCAGAGGAAG
AGGGTGAAGAGATAGAGGACGAGACGGTCTCGTCGTCTGGGCGAAAGgactcctcgtcctcagccGTTGTTGCGCACGACCCTCACGCTGGGTCGCGCCG
TCCTCGGGAATACGACTTGAACGCTTGTAGACCAAAGCGCTCGCGAAACGGCAAAGTGTCAGCCCTCGCTGCAGCGGGAGCGCTCTCGTCTCCGCGCACT
GACACCACAGAGCACGACCCGTGGATGCCAACAGCATTCGAGATGGTTGAGTGGTTGGCTCAATGGTGCAGCCAAACCGCTGGCCGCTCTACGTAGTCAC
CGGCATCATTGATGAGGCCGAGACTAAGCACAGCAAAGGTGCTACTACTATGTCGGGCTCTTCCACGAGCTCTGACACTGTGCGAGTAAGAGAACTTCTC
GCAAGAGTAAAGTGCCTGAGTGGCAGGCACTTTGCCAAAGTTGGA