Description :
From Genome Similarity Track
Location :
Scaffold_33:210144- 219515
Transcript NameFunction/comments
Phypa_INRA-310PPTG_13502hypothetical protein
Phypa_INRA-310PPTG_13503amino Acid-Polyamine-Organocation (APC) family
Phypa_INRA-310PPTG_13504hypothetical protein
Phypa_INRA-310PPTG_13505hypothetical protein
Phypa_INRA-310PPTG_13506hypothetical protein

Sequence
9371 bases(100 bases per row)
CAGGAATTGTAATTGTCATTTCTGGATTCGAGACTCATCCACCATTCGCTTTCATTTTTTGTCTATAGGTGTGCGGTGGACCCATTGGATCCGAGTACAT
CATTTCAGGTTCGTCAATCTGTGCTTGTTGTCGTGCTATATATGTAGCTGGATTGATCCTTCTGCATTGATTGATCGTTGCAGCTGGTGGCCCGTTGATC
GGGTTCATCTTTTTGCTCTTGTTCCCTTTCATCTTTGGCATCCCGATTGCCTACGTTACGGCGGAGCTTAGCACCACGTTCCCGCAAGATGGTAATAGCC
AAGTCTCGATCTCTAACTCGCGGATTTCGAGCTGAACTGGTGTTGGTTGTGGTAACAGGTGGCTACACGGTGTGGGTGCTCAACGCTTTCGGACCGTTCT
GGGGATTCCAGTGCGGTTATTGGGCCTGGATATCCGGCGGTAAGGTGCTAGCTATTGAGATGTAATGGCTTCGATCGGTGACTTGACGCACTTGTGCTTT
TATGACGGAAGTGATCGACAATGCCATCTACCCGGCACTGGCTGTGGCTACGTTCACGGATGTCTATGGATCCATCAACTCGCCTGTTGCAGAATACTTC
ATCAAGGCAGGTATTGCCGTGGCTCTAGCTTTACCGAACCTACTGGGTATTCGTATCGTGGGCCGAGGTATGGCAGTGATGTCCATCTTCGTCATGATCC
CGTTTGCCGTCCTCTTTATCTGGGGAGTCGTTCGCGCGGATGACTGGGACGCAGTGGGCGACATCCGTCGTTCTGATATTATATATGATGAAAACGGAGA
CTTCATAAGCATGTCCGGCAGTATCAACGTAAGTGCCAATAGTAGTTCCTTGATAGAGTAGCTGTAGCGGCAAGCTAACCCCGTGAGTTTTGTAATTATT
CAGATCGATTGGTCTCTGCTGATCAACACCCTCTTCTGGAACTTCAATGGCGCAGTAGGCATGTCGGTGTTTGGTGGCGAGGTGGCCAATCCGGGCCAGA
CGTATCCCCGTGCGCTGATGATCTCTGTGCTTTTGGTAGCGCTCACGTATTTGGCGCCACTATTTAGTGCTACGGTGTTTAACTCGCCGCACTGGACGAC
TTGGGAGGAAGGCTCATTTTCGAGCATTGCAGAAGACATCGGTGGCAGCTTTCTATCGAACTGGGTCGTGCTAGCAACGTTCTGCAGCAATGCTGGTATG
TACATTGCCGAGCTGTTCTGCGATTCGTTCCAGATCCTGGGTATGGCAGAGTGTGACCTCGCTCCAGCATTCCTCAAAGCGTAAGTTGAGTTGAGTTTGG
ACATCTTATTGACGCGTTCTTGTTGACGACTCGTTGCTGATGACTTCACACTAGGCGCAACAAACAGTTCAACACTCCACACAACGCTGTCTACGCCAGT
CTTGTGATCATTCTAGTGCTCATCAAGTTCGAGTTCGACGAAATTATTGGCATGACCAACGCGCTCTCGGCCTTTTATCAATTGTTGATCTTAGTTGCGT
TCATCAAGCTGCGCTTCTCGCAACCAGACATTGAACGTCCATTCAAAGGTATGCGCTCATGAAAAACTGAACCTCAGATTCGCAGATATACTCACCTGTT
TTTTGTTGCTGTCAGTTCCTGGAAACATCGCTGTGCTGATCACTGCACTCCTGATCCCGAGTGCATTGCTAATCTACATTGCCGTGGACGTCTTCTTCTC
GCTCGTTCCGGCGATACTGGTCGTCGGCGTGACCCTGGCTGGTCTCCTATATGCCCGTTGGCGCAAATTCACTCGCGCGCAGTTCCGCCAGCTTACCACC
ACCACCGAATCCTGACACGGCTTCAACGAGATTGATTTAAAAAAAATCTCCTGAACGGGAAAAAAATAGATCGAAACGACGTATTTGTCTGACATCTTCC
TGATTGACTTTGTGTCTATTTAGCGTTTGGACATGGCCCTAAAGACTCCGTTCAAATTCGAGGAATTCTACGAAGCATTTGGCAAGTCTGTGTCGTCTGA
TGTCATCTTTGAAGACGGTCAAATTCACATTGTACCCCGCAACAAGGATCCATCAACCGAGGGCACCAACACCAGCCAGAAGTCTGCACAGTTTGATCCT
GGTAGTCCCCTCCAAAAGCATGCAAAAGGGAGATTGTTGGATAGCGCTGACAGACGCCGCCTGCCCTGGTCCATTCGAGCTTTGTTGGAGGCACAAGAAC
CTGACGGAAGCTGGATCTACTCAAACAACTTTGAGTACATTATCAATGGCACTGCCCCACCTCCAACAGAAGGGATTTCCGGCAAACTGTGGGCCACAGC
GATCGCCATCACGGTTTGGCGCCAGTTTCCAGAGTTCTTCGAGCTACTCGAAACGAACTATGAGAAGGCTATGCTTCACGCTGATGAAAATGTCCTCCGC
ATCGTGCGATCCGTGTTGCAGTTCGATGCACTAGACCAGGTGAGTTGCATCGTCGTTTCTAAGTGTTTGTTCAACCTAACATTTGTCAACGTGAGCTCAG
ATCCGTCCTTACAAAAGCGACGAGGCTCGCGCCATCCGCGAGCAATTAGCCCGCGAGGCTGCAGCGAAGCGTGAACTGGAGCTCGGCGAGGAGCTCAAGA
TCACCCGCATGCGAGAAGAAGAGGCTCGAATCAACAAGCTGAGTTTGGCTCATGCTCGGCGACTGCCGATGTCCACGCAGCAGTTATTTGTCTCCGAACT
CGGCAATGAAATCACCAACGTCTTCGTGTCTGTACCTCCAGTGTTGACGAACGAACGAGAGCCTCAACGTTCCAACTTCAAGGTTGGCCAGCTCGTTGAA
TGCTGCCGTCGCCGCCGCACGAATGGTTCTGTGCTGGCGACAATACCTCGGTGGCATCTTTGTCGTATCGCTGCCATTGACGACAATAGTCACTTGCTGC
AGTTAGACTTCCTTGATCGTGACTGTGAGCGTGAACGGAGGGTTCCTGTGAAGTTTGTACGTGCTACTGTTGCGGGCGGTAAAGAGGCTCGAACAACTGA
GTTTGAAGCTTTAAAAAGTTCTTGGGTTGAACCGATCGCTTGCAAAGCCGAGATCGCGCGACTAGAAGAAGCCCGTGTGATCGCATTGAAGCCGCAGCCT
TGGGATAATCGACACCATCTCAAATTACAAGGCTCAACAAGTGACGAAATCGAGAAGCCAACACACCGCATAGCCGTCAGGCCGGAATGTCATCATCGTC
CTCGATCGTCAACCCGACGGCCGCGATCTCGGGGAGATTCAATGGAGAACGCTAGCGCTTCTATCGACACACTTTTTCACGCTGCGGCAGTTGTGTTATT
ACAATACGATCGCGCCTACGAGAGGGTGCAAAAGGCCGCCCAGACTGGAGCGAAGCGATATGCCACGGCAGTACTGTATCGAGAGCGCTTCAGCGCCTTC
GATGAGCTGACCGATGCCCTCGTGACACTCGTGGAGAGAACTGTAGACATGCTCGAGACCGTTTGGAGGTGGCGCCAGAGTCCAGCGGCTGGTAGCGACG
CTACTTTTGTCTGGAAGGGCGGTGACTTCATTACCACGGTACGTACGTTAATAGACCACACGTTGGAATTAAGGTGACACGCAAATATTTATCAGCAAGG
ATTCTGTTCTCCTGCTGCCAGCTTGTGAGGTCTCTAGATTTCCTAGGGAGCCAACGAGAGCTCGTCGAATGGTACGGTGAGGAATTTCCGCTGGACGGGA
ACCCGTTTATGCGGTCGTCGTCGTTGCTAAACCAGGCCGAGGAGCGTGGTCTACGGCCTGTGTCACAGGAACAACGAATGTCGAGCGTATTGCGCACGGG
GGTGAGTTCGTTCTGTACTCTTTAAACTCCTTCTTTCTCATTTTCTCTTCGGCTCGACGTTTGGATACATGTAGATGAAACAGCGTAATCGCTCGGACGA
CCCGGCGGTGCCGTCGAGCCCCCCATCGTGGTGGCCCGAGGCTCGCTACTCTCGCGAGCTACTTTGCCGCATCGAACTGGCTGAACAGGTGGGTAGCGCT
CGTTCGCTTTACTTTAATGCAGATTCTAACGATTTTGGACCAGACGGTTCTTGTCGAATTGGTGTCTTCTCGATGGCTTATTAAAAGTGGACAATACATC
TGAATCATCCACCCGGAAAGTATCTTACACTCGATAACGTAACATGTGACGTTACCATGAAATGCATGTAATATGTAGAGGCAGTAGGTCCACCGTAATT
AGAAAAGGTTGCAGGACTCAGCACTTCGATATCATACCCCTGAATCTTTGTCAGGACTGATCAATTTTTGTGTGTGTCGCGGTTGCTGTATTTTACATGC
TACATTTTTCATGCTACAATAACGACAGCCTCGCCATTTCACTCGATCATCTCCTTCCAAGGTGATTGAGATACATGTACTATATCAAACTGGTCGCCTG
GAAGTATCACCTCGTTGTGATGGGGGAGCAGAATTTCTGTTGCACTAGAGCTTTAGTGCTAGATCATGAAGGCAGCGCCGCTGCCACAGCGGCGGACTCT
GCCATAGCATCTGCAATGGAATGCCTTTCGGGTGTATTCACTTTAGGTTCTATTTTTCTCACTATCTTTTTTGGTTCGAAATTTGGAAAGTTGCAGCAGT
CGTCTCTGAGACGGCATTGAGCTCACCTGCTCCTCGCGCAAGACTGCGCTGATCGATCTGACTGAGCGAGCGGGTAGCTTGTATCTTGTGTGGAATCCGT
TCTGGTCTAACGAACGAGTGCTGCCAACGCTTCTGGGAGATCAAGTTTGTTGTTGTGGGGTGGACCAACCGTGGTACTATACGATGAGAAAAAAATACAG
TTCCGATGGCCAAAAAGTATCTACTGTAGCAGAAAGTATCTAGCGCGAATCTCTCTTGTCGTCCGTGGCAACGTGACGGCGACCGGCGTGGTAGGCCTCC
ATGCTAAGGCGGATGAACTCCTGCGTGTACTTGCGGTCGGCCTTAATGGAACCCTCGGGCGGCACGTTGAAGTAGGTTCGGCCGCAAATCTCTTTGCGAG
CATTCGTGGGGTTGTTGGTGGCCCACGGTGGCGGCGCGTCTGTGCCGCGCAGTGTGCGCGGCGTGACCTGCAGAAAAGATCGCGCACACGAACGATGTTA
GCTCTATTGAAAAAAGCTCCACAGATTGCAATCCACGTCGCAGTTGCGTCGTCGTACCGATCGCATGGAGCGCGGTTTGTCCTGGAACGGTTGTCCGTCG
TATGTGACCTTGCGCTGAATGGCACTCTTGGCCTCCGCAACGCTGGTAGGCTTGAACACGCCTGGCTGTCGATCGTGTGCATGCATGAGTCCAATGCAAC
GCTTTTAGTGGGAAGATAAGCAGAGGATTGGATAGGGCTGAATCTACATGCAGTCAAGGTATGTAGTCGCACCGTTTTGCTGTAACCTTTGTATCGGCAG
GCTGCCGTTACCAGGTCGGCCTTGGAAGCAGAACCTGCGCCAGAGGCGGCTTCGGCTGCACGCCGTTCTTGGCGAGCTTTGGAATGCTTGCACATAATGG
CAGACCGGAACGTCGTCAGCGGCAGCGTCGTGTCGAAGATCTCCTCGAGCTGCAAGTGGACCCATGCATGAACGAAGCAGACGTCAGTGAATCGTGCGAT
CGTCAGGTCGACGCGAATCCTAAACTTCAAGAAAGACAGACCGAGCCTGGCGGGATGAGGCGGCTCGCGACATCGTCGAGCCTGGATCGCACGTCTTTCG
GCGGCGTGCAATCGGCGTCCGGGACCTGCGGCTCCTGCACCAAGACGATGCTGTCACCGTCCGTCCGTCCGGCGCCGATGGTGGCCAGTGACGGGAAGTA
GCGCACTGAGCGGAAGTTCTCCACGTAGGCGTCCTTGTACAGGCGCTTCTCGCGCTCGTACGCAACCAGCTCCGACTTGTCCACCATGTCAATAAACTAC
TCGTGTGTAGCGCTTTTCATCCTGCTGGCAAGCAAGCACTTGCGCTAGATTCAGCACAAATAGCGCCATCTAAACTTAGATCGGATACGCTGGCTTTTTA
TTAGCGAGGGTGGACTGCTCTACACTCTCAGGAGCTCTGTGTCGTGTTGTAGGGATGCCTGCTTGCCACGCTACCTCGAGCGATCGACAAGCAGAAGAAG
AGCCACGCATCAAGGCGGCGATCCATGGGGGTGCATCCTACCTTCACAGCCCGAGAATCAATCCCACCTGCGAAAAAAAGAGCTTTATTACATGTTACAT
GTATACAGCACGTTGATTCAACGCGCGCGTGTGGTGACCAGAAGAGAACGGATTCGCGGCTTCAGCAGCTCAGCAGCTTGCTGAGCAGCTTCCTTCACGA
ACTGCGTCAGACCTACGGCCCGTAGTGAGCTTTGCTGCGCAGAGCGGCTGGAGACAAATCGCTGCGAGTGGTGAACTGGCCCTGGTGAACTGAACTCTTG
GCAAGATACTTTTGCCTTCCCTACGCCTTTTCGGATCAGCCAATCAGCGCCCTGTGTGGCCAATCTTTCTCATGCACATCACGCTGCCTGTCTCTCGCGA
CTTTATCAGGTGCACTTTGCAGTGCTGGCTTCCGAGCTCGAGGGGCTCCGCTCGTCGCTGAACTTTGCTTCACGCCCTTGCCTATCTACCCCCGCCGTGC
CAACTGCCAAAATCTAGCGAGGATACAAAACCTCCGCGCGTGGACTTCTATGTGCGAAGGGAGGAATCCCTGCTTCCAAACACAGAGGTGACGCCGTCCG
CCGATCTTTTATCGCGGCGACTTGACTTGGACGCGCGGTACCACATCAAGTGAAGAGGAATTGTGGAAAGAATGCCGCAAGCCACGAACAGCTGCAACCA
TAACTCCTTCTCTGGGCTACGTTGCCTCGGCACTCGCAAGTTGGCAGCACTCAGCACGACAGCAGGGCCTCGACAGGCGGAAAGCTCTGCTGGTCTCATG
CTCGCGATCTTCTTCGTTACGACGTCGCGACATGCCATCCAGTGATGTTGCCAATGCCTGTTGCCGGCCCGGCTCTTCCCCCGCGAGCTTCTGCCCTAAC
CTCCAAGAAAACTGAATCGCCTCAAAGTTGACTTGGACTTACTATGAAGGGCCAGCGCGCGAACGAACGAGGTGAGCCAAGTGCAAACCGTCAAGCGTCG
ATCTTGTCTCGCCCAGACCACACAAAGCTCAAAAAGCACCGAGAGAGCGGAACAGATCTCCAGGTCTCGACAGCCCAGACCGCGACGCCGAGGTAAGTTC
CTCTATAGACTGCTGTGCATGCCATTTACACGCCACCGCTCTTCCGCCTGTGCTGCATGTTTTGCGGCTGCTGCCGCGCTGAATTTGCAACACGCGCCAG
CTGGGCGCGGTTGGTGTGTGTGTTTGGGTTTGCGGTTGCAGGCGGCGCATGAGGAAGTGGATCCATCCATTCCTCCATCCCGCTCGCATCCGTTCTCAGT
CACTCCAAGACTCTCCAAGATCGGCGTTCTCACTCCGACTTTGCTTTGTTGCAGCCGACTCAGCACTCGACGATCCCTCTGACGTTTCATACGGCTCTTC
ACCGACGTGACCGCCGTTAGTGACACGCACATCAACGGCCGAGGTAGTATATATATAGCCACCGGCCTCGAACACACAACGTGCCAGTATGGACCGCGTC
AAGAGAGAAGCCTACGGCGACGAAAGCTACAGACGACATGAACACGATGGGCCATTGAAAAAGGTGCGCTCTCGCCGCCACGACCTTAACCAACACAGAC
ACAAGTCGCTAACCTCTGCTACCCTTCCAATCGCACAGGAATCAGAACCGTGGCGTGGATCCTCTGGCTTCGGCCTCGCCAATATCCTCAACCGCAGTAG
CTCCGGTAGCGCCTCCAACAGCGCCATGCCCAAGTTCAGCCTCCCGTCGCTCCACAGCTTCGGCAAGCCGCTTCTCACCAAGCCCGAGGTGTCAATGGTT
CCACAGAACTACGAGGAAGAGAACCAGTACATCTCCACTCGCCACCAACACCAACAGCTTAGCGCTGACTCGTCTCCAGCTCGACAGACGTCACCGTCGC
CCAACTCACGCCGTATTGCACCGGCACCTGCTGACGAAGAAGAGGCGGACCAAGAGGCTGAAAATACGGCAACATCCACACGCGGCGGCAACATCAACCA
GCCGATCCGCGGTGGACGCTGGACAGCGGACGAGCACGAGCGCTTCTTAGAGGGATTCCGCATCCACGGTCACAAGTGGAAACGTGTGCAGCAAGTGGTC
CGCACACGTTCGGTGACCCAGGTGCGCACACATGCCCAGAAGTACCTGCTCAAGGTGGCCAAGCTCAAAGCAGAAAAGAAACAGAGTGGCAAGGTCCCCG
AAATGGCGACTCTGGCTGCTGAGACGCATTCTGGATCCACAGCAGGAGACTCCGTTGATGGCAGTAACACGGCTCCCTCTACTCCAGAACACGGTGCCGT
CCAAGACAGTCCACGCAAGACCCCACGAAAGAAAGTGCGGCGTCTGGATCCGGGTAACTGTGATCCCGTGGACCAAGAGTACATCGCCGCTGCCGCCACA
ACATTGTGTTTCCTCATGAGTCAGAAGATCGACTCATTATTCGACACGAGACACGAACCACAGACGGAAGACAAATCGGACTATGAGCCCTACGACTGCT
ACGCACCACAGACGGCAAGACAACCGGACACCGACCGTAGTGGGTCCCGCAAGCGGTCGTACATGCACTTTATCACGGATCAGCAGGATGACTACTCGTC
GTCCTATGATACCGCTCCCCACGGCGAGCCTTCGTCGTACACAATTGAAGGCAGCAAGCTTTGCTCGTAAACAGCGAGCGAGCCACATTCAAGCGTCAGC
CAGTTGGAAGGAGAATCATCATGATTGCCATTGCACACAGCCTGCTGAAGCTTGCGCGAATGTATATATCTTATGTATATATGGAGATATCCTCGACCAC
GCGTGGCAGGAGACAAGTTGATGAGTGAGGCAGGGAAGATTAGCCGGATTGGGCAAGCCCACCAGCATTTGTAAGTTAGTTGCTATAGTATATAGATCCC
CGCCAAGCCAGGGACGATCGTCCACCGTGAACCAAGAGGATCAGCTCCACCTTTTTAAATTTACTTGTCCATACTTATTTGCTTTACTCATTTGCGGGTT
TCTTCGCTCATGTCAATTGCCTTGGCTCGAAAACTGAGGTGCTTGAAGCAAGAGATGACCTCCAGTTTGTCTGCTTCCACTTCGTGTGCTGCTTCTTCAT
CACGCTTGCGCAGTACCTGCTCTTGTTTCATTAGGAGTTCCTCGATGTCCTGACAATCAGACGCCATTTCCTCCGTCTCCACGCCGCCATTATGCTCGAC
AGCCTAGCAAACCAAACGTGATCGAAGCAACATCAGGAACTTCGTTATTAACCACTGCACTTGTGAACTAC