Description :
From Genome Similarity Track
Location :
Scaffold_215:21014- 22172
Transcript NameFunction/comments
Phyke_g6658hypothetical protein PHYSODRAFT_262310

Sequence
1158 bases(100 bases per row)
TCATACCGTCGGCCAACCACTCGAGAAATCAAGCTTGTTCCAGCCGAAACGCTTATCTCCGTCCGCGTATCCAATACGAGTGTCCACTACACAATCCAAT
GAACAGTtagaagaagaggagcaaAGCGAATACGACAATAAAAGAATTGAAAGGGCCACTTACCGTAGTGATAGTACAAGATAGGACCGTTCTTGGGGTC
GTTGTACACACCTTGGCCACCCGGCCCGTAGACAAAGTCGTGTGATTCGAGCACGATTGTGCCGCCGTTGTTGCGGCAGTCGTTTCCGTTCTTGTCGACA
AAACCCGACGTCGCACTCTTGGAACGGCACACGAGAATGCGGTACTCCTTGCCCTTGGCAGGCCGGGTCTTGTCGTAGCCACAGCACGATCccttggaga
agaagaggtaGTAGTAGCCATTGTACGAAAACTCATAGGCAGCCTCTACAACCTCAAAGTTCGAGTGAAATGCCAATTGAGTTCCTGCTTCGCCAGTAGT
TTTCGTTGGGTTTGATGCCATCTTAACCTGGAAGAGGTCCTGCCAATAGCTACCAAAGTTGACGTAGTATTGGTTGCCCACTTGGAACAGGTTCGGGTCA
ATGGCATTGTAACTTTTGGAGGAATCACTTGTGATGCCCACGCTGCCGAGATCCGTCCACGAACCCGCTTCCATGGTTTTGGACTGTGTAAGGCCGATTG
CGGAATTTTGCGTCCCGAAACTGCTCACCGAGTAGTACAGGTAGTACGTGTCGCCAACCTTGTGAACATCAGGCGCCTAGGTGAAAACGCACGCAGATGA
GAAATGTCGTCAGTGTTGAAATCGAGAACGTTTGAATACAGAACGGTGTCCTCACCCAAAGATCATCTTTACCGGCCAGATTGATGATAGAACCGTCGGG
AACGGCAGCGCCTAGATATTTCCACGGGCCTGAGATCGCAGGGGCCGAGTGGATAGCGATCTTGTTACCCGTCGAGAAGCGGAAATACGTGCCATCGCCG
CGCTGAATAATGGAAGGGTCATGGGCGTTCGTACAAACTCCGGTGCAAGTCTCAGGGTTGGCATAGCCGTTCACGACACCGGCAAGAACCAGAGGGAGAC
TCAAAAAGAGCGATAAAAACTTGACCATCGTTTAGTTGGCGTCGACGAGCTGAAAATG