Description :
From Genome Similarity Track
Location :
contig_34:210120- 211430
Sequence
1310 bases(100 bases per row)
GTAGGAGTAAATTACTTAAGTTCAGTATACTTGTATCAACAAGTATACTTAAACCTAGATAAATGAACCAAACGGAAGCTTTGGTGGTAAATGAGAACTG
TATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCA
TTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATGCCTTAGTGCATGTTGC
ACTAAGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACACCATCCCCCCGTTAGGATTTGACGTGCCGGTCTCGACACGTCAATCCGTATTTTCTTCGG
GAGAACACGTGCTCATTCCCAATGAGCACGCCAACGACGTCTTCGTCCAAGACGCCGGCCGCTTCGGCAACAGCAAGTGCTGTCGTCGCCTCCAAGGCGA
CGACGGCCGCTGCCTCAGCCACGACCGCTACTGGCATCGCCTCGACGGCGATGCCGACAAGCGCGGCAACAGAGAGTCGCCTCTCTGTTGCTGGATACCA
CTCAAGATGGCATGAGAAACATGCCATCCGAAACAAGACAGGCAAGATCATTGCTGTCGAAACCGGAGTGGGTATCTACTCTCCGGGTGGAGAGGGAGTT
CCCCTCGACTACGGAAGCGAAGTCGAGGAGGGGGAACTCGAAGGAGACAAGGACATCTTGTCTCCGGGCCACACTGACCCCAATGTGGGTCTGCGTCGTC
CACGCGAGGACGACCCGAACGCTTCGAGCTCGAAGCGTTCGCGCAGCGGCAGTGGAACACCGCTCGCTGCCGCTGGAGCCTTGTCGACTCCGCGGGATGG
AGATGACTCCACTCCATCCGCTGCTGTTGCGGCCTCGCGCACTGAACCAGTGCGTGAGCCGTGGATGCCGTCTCAGTCTGAGATCGGCAGCCGATTCGGT
GCGACCGCGCCACCGAATCTGTACGCGCTGTACTCGTGCAACGCCATCGTTGACGATGACGTCGCGAAGCGAGTACACTTTGATCCGTTAACGAATCAAA
GGCGCGACTACTACATCGGGCTCTTCCATGAGCTCCGATGGTTTGCGAGCAAGAAGACTTCTCGCAGAAGCAAAGTGCCCGAGTGGCAGGCACTTTGTCA
AAGTTGGAGTGCCTTTGTTGAAAACTTCAACAAGAACCCCGCTGGCTATCGCGACCGGATTAGCCAGGCGCGGGAGCGCTACGAGAAGTTCTCGAAGCGT
GGTAAACTTG