Description :
From Genome Similarity Track
Location :
Scaffold_1552:2101- 4342
Sequence
2241 bases(100 bases per row)
CTAAGCGAATGTTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGCTCGCTTGCCTTTGTAGTTCCTTTGC
GTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGAGCCTCTAGGGTATGACCGACCAAGTAGTAATTCGGTTAACCCGTCGGATCTGCACGT
GTATGGGAAAGCTTACTAGGATGTAGGAACTGGCCAATGTATTATCCGGTTATCACTACCAACACTAGATTCGCAATTCCCAACCTTCTCCGAGCTCGTA
CGGCCAATGTAGTTTCGGTTCTTGAGGGCAGGAAGGCACTTGCGTGTTATGTTGCAAATAGAAGACTGTATTGATACTTAAGCCTATACCTGCCTGGATT
TCTACCTTCTATGTCTTTTTCTTGCTAAATCCCTTACCAGGCCCGGCTGCATGTCCCTTCTCTCCTTGGCCCATCATCCCAGCTGTATTATCTTCAGATC
CACCGGATCCATGACGTAATCATTATGGTCACCCTATTATGGGTACACTCATCTGGATCCAGGTCGCTGGATCCACTTCACTGTAAGTTTGCACTCGTCG
TGGATCTGAGCTCTCCAATCATCCAACATCATCTTGCAACCGTCTGTGATCTCCATTTTCCCACGAAACTTCGAGATCCACAGCATCCATCATCTCTGTA
CCCTGGATCCAGGTCCCTCTCTGCGGGATCCTCTCTCCTTGGATCCGAACTCGGAAGTATGGGACCCGGGACACCTCGCGGTGGAATCATGACTTCTTGT
TAGCCGTGGCTACTAGATCCACCTTCAGAGGGCACCTACCATCATCCGTCCATAGGATCCACACTCGATCCACTTTCATTTAGTATATCCCATATCCATC
TAAGTGAATCCAGGTAAGGGTGGATTTGAGATAGGTCTCGGTGGATCTTGCCTTCCCGTGCATCACCCATACCAGATCCATCGTCGTTTCATACGGGGGG
CCGCTCGTCATGGCCAATCCACCACAGGCAACTTGCATCCGTGCCAGACAATCCAAATCCTCTCTAATCACTTGAAATTGTCACTGATTCGGGATAGTGA
CCCCTCGTCAGGTCCGTTCTCTTATTTCTGAGAAAGCACTTCACCACAACCTCCTTAGGGAGATGGCGCTCGCCGGATCTGAGATGCACCAGCTCCAATC
CCGGATCCATGACCTCGAGCGGGATCTAGAGGATTCCCAGACTGCTAGTGCAGCCGCGGACGAGAGCTTAGATCGACTCCGTGACAAATTGCGCCTGACC
CAAGAAGAGGTGGTAAATAACGACTATGTGGGATCCACCCATGGCGGATCCGCATTAGGGTCGGCGCGTGGAGGGTCCCCCGCGCCAAATCCACCTCCCT
CGTCGCCGGATGTGGCTCTGGCTCAACTCTCTGAGGAGTTGCAAGATACCAATGAGTCGCTCGAAAAAGCGTCTTCTGGACGAGATTACGCGCTCGAAGA
GTTCGTGCGTATAACTCAATTGCGTGACGAGATCCAAACAAAGCTGGCGGACAGCGAGCTCCAACGGGACAAGGCGGCTACCGAGTGGGCGGATGCCAAG
CGGGCGCAAACGGAACTGGAATCCAAGCTCCGCCGCACGATTACGTGGATCCTCTTTTGTCCCCCGCTAGTAACCCCATATTCACCTGTTATGTCAATCT
AGGTGACAAATTAAAAGATGCTGAGGCAACCGCAGCAAAACTTCGGGATCAACTCGCTGCAGCTCATGTTCAGCACCAGCAGCTAGTTCTGGAGCGCGAT
CGTGGCTTATCGGAGCGGTATTCGGCTCGTCGACGACTGACGCTGGTGACAGCTGCCGTTTCGGATCCCCTTCCTCCCCTGTCTGGGCCCTCTCCTGCTA
CCAGCGTTTCTGCTTCTCTACCGTCTGTAAGTGGGGCGGATCCGTCGGCTGCGAAACGACCGCGTAGTGCATCTCCCGCTCCTAGCACTGGATCCCCCCC
GTCCTCACAAGCATGCCCGAGCTTCCCCAAAGGCCAAGCCCAAAACCAGCTCGGCCCCTAAGGCAGCCTCTCCGGCGGGATCCACATCCACGTCCAAGGC
GGGATCCACGTCCACGTTCAAACTTTCCGCCTCCCCTTGAAGGCTGGTGCCGGATCCAAGTCCGGATCCGCCACTACATCCAAGTCGACATCGGTGTCTA
AGACTGGATCTGTGGCTACGTCCAAAACGGGAGTGGGATCC