Description :
From Genome Similarity Track
Location :
Scaffold_8:2100699- 2102159
Transcript NameFunction/comments
Physo_339429Hypothetical protein

Sequence
1460 bases(100 bases per row)
GGTAGCAGATCTAGTGTTGGTTGTAAGACTGGAGTAATATATTGGCCAGATCCAGGACCTTCCTAGTGAACTACCTGCAAGTGCAGATCCAAGATCCACC
GGAGTTATCAGTTTGGCCGGTGCGTCCTCTCATCTCAACTGTCAACGACACCGTCATTGGAGGCGGCAAACACGACCAAGGAAGACCTGCGAAGGCAACG
TAAAGGACAACAACCACGAAAGGCAACAACCCGGCCGGATCCAGATCCAGGCCGCCAGATCCAAGTACAGGGCCACTGGATTTGGAATACTACCGCGAGC
AGAGTGAAGATTTCCACGCTGCTCCACCCACATCCCCGCGTCTCACCCAGACTGATCTGTCTTCAAGGTTCGGACGCTTCAGCAGACACCAGAGGAGCAG
ATCCAGCCCTACCGACGGGTACACAAGGTGACCAGTTCAGCACACAGATCACGGATCATCGGGGGACCCCCTCTGTAAGTCGGTGTTCGGGCGCAGTTGG
TAAGTTGGATTGGCAATCTCGCAGATTTTGCTGATCCCGCTACGCCACAATGGTGCGCGTGCCCGGATCTTCTGGTGACTCGGGATTTCACCGTGAGTCC
CAAGAAGAAGTTCGAGTGAAGAAGGAACAAGGGGATCAAGCGTCTTCGGAATCGGGATCGACGACGACGCTGCTGAATGAAACAAGATCCACGGATCGGC
AGAGTGCAAGGAGGACCTCTATCGGCGGAACCGAGGTGGATCCAGACATGGATCCAGAAGAGAAACCTCAACCTCCTCCACAGGTCCCTTCAGGGACCCC
GGTGATTGCGACGAAAGTCAAGATCCACTAACAAAACAAACCAAGGCTGGCCAGGATCGGTATGCATTTTCTGACTCTCCAGTCAAACAAGAGCCCTACA
TCTTTCATCCAGACAAGACCCAGACGAAGAAGACCGCTACGAGAAGGAAGATGAAGGCCCCGGAGCTGGAGGACGAAGATCCAGAAACCTCGGCCCAGGA
TGGATCCGAGGCATCATGGATCCGTCATCACGAGAAGCAACTACGCAGCTTTCTGACAGTGGATCCAATTATGCAGAAGTTCGGCGTGAAGCAGATCGGA
GCCCTACAGGGACCCTTGACACTTCCGGCAGCCGTTAAGCGTCCAGGAATCTTGGCAGAGATGGAACGCTTGATGCAGCTTCTGAGGGATGCCGGTCTCG
TGGCTGGAGCGTTCGACGCGTCAGTGATGTACGAGATCGATCCAATCCAACTCCGTGCCACGACGGAGATGCTGTTCAACCGGCTGAAGGTGCGAGATCC
AGCCGAAGCCGGATCCCGCAATCCTGGATCCAAGATCACTACAAGAAGGATCCACAGGATGTCGGACGTCGTCACCTTATGTGTCGGCTGGTCGGACACG
TCTTCGGAGCCGCGACGCATGTCACTTGGACCATCGGGAGCCTCGATGCTACGCGCCCGA