Description :
From Genome Similarity Track
Location :
Scaffold_306:21005- 27718
Sequence
6713 bases(100 bases per row)
CAATCACATAGGAGAATGAGAGCATGGGAGTGTACATAGACACTAATCCATTCTCAATAGCCCTGTTTTCTTAACAACCCGTTGTCATTGTCACACTTCA
AGGATATGCCACCAAGTGTTTCAGCTTTTGCAACCTCCTTGACTCGCACTATACTATGTCGCGAGTAGACGACACTCTCGAAAGGTCGGAAAAATCACGT
GGCATACGACGAACGACGTTTCATCCATAATAGTTGAAGAGACCAGTAAAATGCGATCGATCGAGAAAAAGGCCGATGGAGCTTTGGTTCGTCGCAAAAC
CGCGCCCGTCCCCGTATGCGTTTGTCGTGTACCACATACAGATGTACGTCGTCGCTGTGTAATTGTGCTATTCAGGAGGTCATCATCCGCAACATCTGCT
ACTTCACCTGTTCTTATGGTTTTCACCTTCAACAGCAGTAATTTCTGACTTTCTGTCGTGTGACTTGATACCCTCTTTCGTTCAGTTGTTGGTGTCTCTG
CACCACACTGCATCGATTTATTTGCGCCTATGAAAAAGTACGAGCGAATTCTCTTGGATCAGATCCATCGTCGACATGACGAACGACGTTTCATCCATAA
TAGTTGAAGAGACCAGTAAAATGCGATCGATCGAGAAAAAGGCCGATGGAGCTTTGGTTCGTCGCAAAACCGCGCCCGTCCCCGTATGCGTTTGTCGTGT
ACCACATACAGATGTACGTCGTCGCTGTGTAATTGTGCTATTCAGGAGGTCATCATCCGCAACATCTGCTACTTCACCTGTTCTTATGGTTTTCACCTTC
AACAGCAGTAATTTCTGACTTTCTGTCGTGTGACTTGATACCCTCTTTCGTTCAGTTGTTGGTGTCTCTGCACCACACTGCATCGATTTATTTGCGCCTA
TGAAAAAGTACGAGCGAATTCTCTTGGATCAGATCCATCGTCGACATGACGAACGACGTTTCATCCATAATAGTTGAAGAGACCAGTAAAATGCGATCGA
TCGAGAAAAAGGCCGATGGAGCTTTGGTTCGTCGCAAAACCGCGCCCGTCCCCGTATGCGTTTGTCGTGTACCACATACAGATGTACGTCGTCGCTGTGT
AATTGTGCTATTCAGGAGGTCATCATCCGCAACATCTGCTACTTCACCTGTTCTTATGGTTTTCACCTTCAACAGCAGTAATTTCTGACTTTCTGTCGTG
TGACTTGATACCCTCTTTCGTTCAGTTGTTGGTGTCTCTGCACCACACTGCATCGGGTCTCACGATTAATCCGACGGGCCGCGCAAGCGGTCGTTAAGAA
ATACTACGGCTGGTGGCGTTGCTCCGGCGACTGCGCAGTTTAGATAAACGTGGAGCTCGAGTGAGCTTAAAGGCAAATAAACAAGGTTGCACGTCTGATA
CTATGCTACAACATCATCGCCGGGTAATATCCAGAGCGCCACCAATGGCAACCAGCACCGTTTGATCGCCGCACTCGATCGAGCATGGACATTGCTTTGT
TGTCTATATGAATTTTCGACATCTTGCAATTAATAACAGTAAATAGACACGTCTACCTCTTTCTTTCGTTCAGTCGAGGACGATGGAAAAAGTGTTCTTA
CTTGGACACACATCAGCGGTTGTCGACTAGATCGAGATCCATGTAGGTAGGCGAACAGGTCAATGTGCGTATTTGATCGTTGTACGTCACATTAACTACG
TAGTCTGTTGTTGAAAAAATCAGTGCTTTTTGGACTTTCCTACGTAGATTTTTAGCACAAAAGGCTTCAAATTGGAACAAATATGTACCTTCAAGCGCTC
CTTACACAAAACACTGGACAACTGGATGCTGCTGTACATGCCCGATGATTTCATCAAGGCAATTTTTACACATAGAACTGTTTTTGGGCATTTTTGCCGA
CATGTTTTCAGGTAGCGATAAAGTCTTTTAAGGGTATCAACAGGACAGAAGTCAATCAGTAGCGTCACAAATCGAGAGTGGCAGGCAAGGGCTTTGGCAA
CATCATAGTACGTGCAGTTGATCCTACTTAGCTGTGAATAGACATGACCTCGCGGAGCTGCTGAATAAAGCTGCAGTGTGATTGCTCGAGTTGGATTGCG
GTCAGTTGCCTGTGTCCGTGTTACTCTGCTGTGGGTTTTTGGTTCCATCTAACCAACTGTAAAGTGTTTCGCAGACGTGATGGCTCTAATACCTAATTTC
ATTACCGCACGGCGCATGTCACTTCAAAGTGTTAGGTCATACGTATCGATACGATCTCGGTAGACTCGGGTGCTTCCCAATTGCGATTTTTAAGATGCGT
GGCCATCTACCGTGTCCTAGAACGCCATAGAACTAAACATTAGACCTGAGTGTGACAAGATAGTTCCGCCGCTCTACATCACCTTGGCCCAACTAGCGAC
ATCAAACACTCCGACCACGAAAGAGTCAACTTTACGGTACACAGACCAAACTGGAATTGCGCCATCGGCTCAGATATCCTGACGACGCGCTCCGACTCCA
CCCAGCCTTAACATTGCCATCCCCTTTAATCCAATCGCAAGCGGATCTACAAACTCGCCAACGACGTCAATATCTGGAATTGAATCAGGTCCAGCCACAT
CGCCACCCCTTCATCTGTTCGCAAGTGGGTTGGTGGGTAGAAGATCGGGGTGAGCACAGCTTTAGTTCTTGATAGCTTTCGTGCTAAAAAAGGCAGGAAG
ACCATCAAGAATTATCGCACGGACACAATGAATGGAAACAAGCCAGATCCGACGCGAGACCCGATCTAGCAGGTGTGTCGTGGAACTAGCTCGGACATCT
TAAGATGATAAATATCTGGTGGGGTCAATTTCTCCACAGAACAAAATATAGTGCGCATTCAATACATGAAGTTTGCAGCGATACGTCAGCCAGCCCGCAT
CGGAACTGCATACGTCGCCAAGATGTGGATCTCTATCGCATAGGATCGACCTTCGAGCGGCAAAAACAGCCGAGATACTCGTTGCGGGGACCCTTCGCAT
TTTCCTTCTCGGTAGCCTATGTGGTCCCGCACCCCTATTACAATATGGGGATTTTCCACCAGAACGGCTTTCAGCCCACCCAACTACCGCACACCCCGAA
TTGCGAGTTGGCACGGCAGCAAACCATTGAACGGTTGCTCTTCTCCTACAATGGCCTATCTCCGGGGCCCTGTAGTCGACCCCCTCCCACCACAGATACC
GACCTAGGTACCTCTCGGTCTCAGTGGCGGAGCTTTAACACACAGGGCTGGGATCGGTTCAAAAAGCTGAGGAAAACTCTCTTGAATTGGTGGAAACGGT
CGGCCTTGTCGTAGAATCCCGAGCCGGTGTGGCTATCAAAGAGATGCTGCGATTGCAAAGGATCTTTTCGGTAAGAAGAGAAGATATTATCCCTCAGGAT
CACCGGTTTGATCTCTTCGAATGGTCAGCGGGAGTATATAATTGGGGGACATGCATGGAGACTAGGGTGGCAAGAATTGTCCACGCTGTGTGGCGCTAAG
AATCATTATTTGGAAGTACACAACAATAACATCACCTAGTTATACGCAAAGATATGCTCTTTATTAAATTCAAGCAAGTCTTCGATAAGATCTGCCTATA
GACTACCGGAAACATACCATCAGTTGGGGGTCGAAAGTCAGATGTTCGAACAGGCGCTTTGGACAGCACAGGTTTCAGTGCGAGAGTGAGGCTATACCTA
TTGACGCGATTTATAGGCTGAGCGTGTCAAGAATACGCTGATTAAAAGTTTCTGTACCGGATCAGGATGACATCCAGACAATAGAAGCGGCGTATCTGGC
ATTCTTTTCTAGCCAAAGGCGGCTGCAACGGCAACCTTAGGACAGCTTTCACTACTAAGGGGGGACCATGGAGCGATCAATCAGGTCAAAATGAGATGGC
CGACAGTGACCTGCTCTGCGACTAGGCTACATCGGAAGTGCAGACGACAGACAACTAGCGGATATGCTCAACTGCAGGCATGGCCGCGCGTGTCCAGACT
GAGCAATAGGGCAGAGATTCATCTGGATGGACAGAGATACAGCAAGAAAGCACAATACATCACCTTGCATAATTTAATGGTGAACTGGACACTAACATGC
CGGGGGTAATCGGCTATTGCGCAGCAACTTGCAGTCTGGTAGCGCAACTCCAATGTGGTAGACGATGGGTAAAAACGTGACGTTAAGGAGGGTAGTGTTC
GAAAGGTGCAAGAAGTTACACAAGTATTTGCCTTTAAGTAATTCCTGGGGCGGGCTCAGAGGTCGTTAAGAAAACCAAGCGACACATCTGCACCTTGTTT
AATTGCTATTTGTTTAATTGCTATTTTAACGCCAGCATATTCATCTACACGTATGCAACAGTTTGCTATATTTGAAATTATAAACTATAATATATGCGGA
ACGTAGTCGCTTTACCAGCTATTGCTACGACTGAGCCAAGATGAATGTGAAGCATGTACGGAGGAAGACATGTTTGCTTTGATCGTCATACTCCCACAAA
AGATCATTTTGCTTAAGCCTTTGGTGCACCACGTCTGATGTCTTGCATCTGCGAACCCAAACGAGGCAACAATTAGGCACGGTAGCCCGATGATCTGGTT
TTGTGTCAAGCAAAACGTCATCCATCAGATACCCTTTTCGAAGGTTGAAAAATCATCGGGTAGTATGTGCTGGCAGGAGTGACCGTTAACAACCTTTGTG
TAAATTACGAGCAGTCTCCGTCGTATGCTCATCATCTATATCGTGAAAATACTGCCAATGCACTGGTTCCTACTAGTTGCAAGGCTGCGTGGAACTGAAG
GAGAAGAACGTCGAGAGTAGCACTAGAACTTTGCGGTTACGTTCCCATGGCTGTTCGGGAACTTTTGTCAACGTCATCGCACCAAACTCGGTCGTAAAAG
ACCTTGTAAGATATCCAGATTGCACAATTATGTCGCTGAACAGACGCTGTAGGAGCATTCATAGCTTTTGATAATCTCCTAGTGTGCATTTGGTAACTAC
AATCATGGAAATGAAAGCTCGTTCTGTTTTTCTACTGTCGTCACATATTGTAATCACAATCAAGTACTCATCTCTACTGATGAACAGCAACACTATAGTC
TAGGTTGCCCCTCTTCCTATAGTACTTTGCTTTCCCCATCGTTGCCACCAAGCTTGTGAATTGGGCTGGTTCACTATAATTGCCACATAGCACGAAGTAG
ATAGTGACGAGGATACAGACTAGTCGTTTTGTGGTGAAATATTGGTCATTCAGCACATAAGATGCAGCAAGTAGTGCATGAGCGGTAGACTTCGGTACGC
AAGATTGTATAATCGGTAGCTCGTTCATACCAATGCTACTGATATTTTGGCCAGTCACACAGGCGTTCGCAGATATTAATAACTCTCATAGCAAAAGCGA
ATACATATTAGGTCGCAGATGATATGTACGAACTAGCACCTTTTTTCTCGATGGCAATGTTCGTTCAGTCAATCGTTGACTCAGATTTCAATGAACAATC
GGGGAACGCTAGGCTGTAACGTGCACCTGTAGAGCATCTTAAACGCTATAAACGTCATCTGGTGAAACAACTTGTGATCCAGAGAAGATTTCGTGTAGAG
ACAACGGGCACTGTAACGGAGTGAGCCTCTTACAATTAATTAAAACCTAATAGCTGCTAATCAGAGTATTACCTTAAAGGGTAATGTTTAGAAGCACTTG
CTCATTGGCTGATATAGGTAATTACATCAGTCATCTCAGCGGTCCAATCAATGTGGACGCGCAATGAGTGGTGAGCAAGACTTCTCCATACATTTTCGTA
GATAGACAGAATTAAGTTAGGACTAAAACATAGGCTAATGATTGGGACTTAATTATATTCAATACAATTTTACTTTCTACCTCGATCAGACAAGAGTTTG
ATAGCTAGTCTTCCTCTGCACGTACCGTGTACGTGAAGTGATGTGCGGCACTGCTTACACTGTGTCAGTACAAGTCACCAGTGCCCCGTTACAGGCACGG
CAGTGTACTGGATATCAAGTCGTCGTCACTACCGACGAGGGATAGTCAAGATCAGACAAGGGAATCGTGAACAAAAGCATAACTTTCAAGCATTGAAACT
AAGTTGTCAGAGGATGAGTGGATTGCAAAAAATGGGTGTTGGTACTGTAACACTGATTTCGGCTCAATCGATACTACCCTGACAAGGACGCCCGGATTTC
CTTAAGTCGAACAAAGTTCAACATGAATTTTGTGCTTGCACACGACCTATTGCTGATCGAAATAGTCGACGGAATGGTGGGTCTCGTTCACATTGCTTCC
GTCTCTACAAAGTCGCAAAGAGAAGGCACTTCTGACTGGACGAAAGGAGCGGGCTTGGTCTTGTATAGTGGACGAAATGGGTGGAATCGAGAAAATTGGT
GAGACCGTCGTGAAGAAGAAGCTAGAGCCCAAAGCGAAACATTATTACCTCAAGGTGCATCAATACCTTTTTCTACATCACTGCCCTGTTTATTGTGACT
CTTGTAAAAGCTGTAGGTATCGTTTGCGCTAAGTGGATACCTTTTAAGCTGCTTCGAAAGCAATGTCTCATATGATGAATGTTATGACTACGATGGGATC
TGCTCGACTATGCGTCAGCAGAATTATGGTAGTTTGTTGTGTAGTATGTAGCACTAACATTGATGTGAAGATAATACTTCCGTGCAAGCCAATGCGAAAT
CTATACCAGGGCA