Description :
From Genome Similarity Track
Location :
Scaffold_10:210012- 215346
Transcript NameFunction/comments
Hyaar_Emoy2801945hypothetical protein

Sequence
5334 bases(100 bases per row)
TTACCGGAAGAAGTCTCGTACTGGTGATAAGGTCTAAGGCGACCGACGTAGAACGTAGGATGCGTGCGCATCTTACGTGGTAGTTCAATCGTGTATGCGT
TGCCTATGCGGCGCAGCACACGAAGTGGACCGATGAACTTGGGTAGTAACTTGTTACTACCCACGTTAGTCACTATGTGTCAAGGTAAATTTACCGGAGA
TAGTAGGACTAGGCCATCTTCATTGAATGAAAGAATATTTACCCTTCCATTCTTGTCTGCCTTTTTCTCTTGTCGGTCCACTGCTTCAGCAATGAAATTT
TGCACGAAACGGACAACCGTTTCGCGAGCCAGTATGAATTCATCTGCTGACTCGCTGTCTTTGGCTGTAGTGCGCTTGGAGCGCACTGTGGCAAGATCAG
TGACCTGGGTAGTAAGAGCATCCTCGCTCTTACTTTCCTCTTCTTCACCAAAGTCGATGTGATCGACATCGGCGTCATACGTAGTGACCTCGTGGTCAGT
ACGTGATGAGTGAGAGCTGACTTGGAGTTCGCTCGAATGAGTCCCCCCCCTCAATATAGAGTTACACTCTAAGAAGGTGGGTAGGCGTGGGTAGCGCAAG
CCATTCACGAAGAACGGTGTATGGGTAGTCGATGCTTGCACCGAGTTGTTGATGGCGAATTCCACCATTGGCAAGAAATCGCTCCAATTCGTAAACGAAT
GGACATAACCCCGAAGGATTTCCTCAAGAACTCGGTTTGCACGTTCTTTCTGACCATCTGTTTCAGGGTGATCAGAGGTCGACATCTGAAGGCGCGTTCC
GAGTGTTTTGAACACGGATCGCCAGAATTCCGCAGCAAACCGTGGGTCTCGATCAGAGAGAAGTTCACGAGGCAACCCATGAAGACGAAAGATCGTGTCA
ATAAAAACACGAGCACATGCCGATGCATTGATAGATTCAGGTACAGCGACCAGGTGTACTATTTTACTGAATCTTTTAACGGACACAAGAATACCTGTAT
TCTTGTGTGGGTCTCTGGGGATTCCAAAGACAAAGTCCATTGAGACTGATTCCCAGCATTCCGCCGGAATGGGCAAGGGTTGCAACGGCGCACGAAGTGA
AGGACCAGACTTCACTCGTTAACAGACTTCGCATGCGCGGACGTACTTCCGCACGAACTTATATTGGCGGGGCCAGTAAAAGTCACGACTAACTGTGAGA
TATGTCTTCTCTCGACCACGATGTCCACCAGTAGGTGCATCGTGGTACTTGTACATGGTGCGCAGTCGTAGGTTACCATGGTCCGGTACGACGACACGAG
GTGTGTCGCCGGCAACGGCTGTATACGTTAGTAAGCCATTGTGGACTGTATATCTATCCGTGGAGGGTCGATATACTGGGGGCAACCTTTTAAGGGATTG
ACGGGATGGTTGCGAAAGATGTTCCATCAAACACACCATCGCCGGATTGTACGCCTTGCGTATGTCTTCTAATATGGTTGACGACGGGACACTTGACTTC
AACACCGCGACAGTGGTCGGACCAGTGTCGGGTTGCGCAGCCGGTTCAAAATCGGGCCGGCGCGAAAGAGCATCAGCGACGAAATTCAATCGTCATGGCT
TATATTCCACGTAGAAGTTATACTCCGCGAAGGACGACAACCATCTCGCCATTCGTTGCGAGAGGTGTGGACTGTTAACGGCCGTGCGTAAGGATGCATG
GTCCTTGTATACGATGAAGGGTCCATCACCTAGTAGGTAGGCACTGAACTTCGCCAAAGCATACTTCATGGCAAGGAGTTCCTTGTCATGGACTGGGTAG
ATACGTTCAGCTGGTTGCAGCTGACGTGACTGATAGCAGACGACACGCTCAGCACTGTCTGTGTCGTACTGCATTAGTTTACATCGGATGGCAAAATCAC
TTGCATCGCAGACCACATGAAATGGTCTGTCTTGGTCTGCAATCGCCAAAACTGGCGAGCGTATCAAGCTTTGCTTGATACCTTCGAAAGAGCGCTGGCA
ATCAGCACTCCATGCCCACTTCTCGTTCTTTTTCAATAAACGAGAGAGATGAACAGTCATCTCGGCGATATTGTGCGAGTATTTGTGCAAATACGCCGCT
AGACTAAGGAACTTTCGAAGTACTTTTATGTCGGTAGGCACTGGCCAGTCAGTGATCGCCTTGATCTTACCCACGATGCATCCAAAGAAGTGGTATTTTG
CTTGCAGCAAATACACACTTCTTGAGGTTGGCATACAACTTATGCTCACGCATCAGTGTAGGAACCTTTTAGACGTGGAGTTGGTGGACTTCCAAATCCG
TCTGTCCATCCATAGCCCGGCTATGGACGAATACGACATCGAAATAGCTAGGTGAGAATTCTCGCACAGATCTGAACAGATTCGTAACACATCTGTTGAA
CGTAGCAGGGGCATTACTCAGCCCTTGTGGCATTACTAGCCACTCCCAAAGCATACCGCTTGGGGTGATCACTGCTGTATAAGGAATGTCCTTTTCTCGC
ATAAGGATCTGATAGAACCCGTCCATCAGATCCATCGATGAAAAGATGGTACTCCTTGACATACCATCTATAATGACATCCTTTGTTGGTATCGGCGTTT
GAGCCGGTACAGTGGCAGCATTCAACTTGTTGAAGGCATGTAATATTCGCCATCCTCCTGTGGCCTTTCGGACACAGAAGGTCGGAGAGCTATGTGGGGA
AGTAGATTCCCTCACATGGCCCGCTGCTAAGAGATCGGCAAAGAATTTGTCAATCTCTAGTACTTGCTCACGAGGCAATGGCCATTGCTTCATGACACAG
TACTTTGAACCTGGTTTCGGGTCTATCTCGTGACTAGTACCCTTATCCTTGGGTAGCTCGCACGGCACTGTTTCTGGGAACACATCCCTGAATTCCATCA
AATCATCGTAGAGAGGATTTGTCTTGAGCGATTCCCACGATTGGGATGTGTATCGCTCAACCCGAGTCTTCTCATCAAGGACACTCTCGTCCATTGATGA
GCTGCTGAGAACCCTTTCGTTCTCCGCGAATACCATTGCCGACCGAATATCGGTTACGTACTGTCTTCCGCGACGAGTACGCAAATCTGCTTGACTTTGC
CACTACGCAGATCACGGAAGAACCTTTTCTGTTCGAGCGTGGGCAATTGAATGATCGCCGAAGTTGTCTTCGGAGGCGCGATCAGATCAAGTTGGTATGT
TCCTATGCTTGATCCGTCATTGACTAGGACATTTAATGTCTCTGTTGTCTCCTGGGAACTTATTTCCACAGTTGGGTGGGGACTTATTCCCTCACTAGCC
TCTTTGGCTATCTCATCATTTGACACGAGTGGAATTGCTCCCTCGCTATCCTCTGGCGGTGGTTGCGCTACCGCGACCAGGTCTTCTACGTGCGATTTTC
CAATCTTACTAAGATCATCGTATTGCCAATCATTGGCAATCGGTTCATTTTCACTTGGGTGTTGTCCGTTTGGAGGACACCCATACCCCAGTCCACTAGA
CTTATTCGGGTGGTGGGCCTTCGGCGCGACCTGCGTCTCAATGCAGTCGCCGGAAACTGACTCCATGGTGTGGCGATCAGCCACTATATGGCCATGTGCA
GTCGTACTAACGACCGAACCACACGCGAGGCCATCGCACTCGCTCGTAGTACACCCACATGTTAGTAGGCGCTCCATGGCGTTCATCAGATGGCCATCTG
ATGAACAAGTGACAGGCATATCGACTGTTTGTCGATGCCAGCTGACTTGTGGCTCGTACCGTCTGAGCCACGGCAGTCCAAGGATGACATCAAATTTGTC
ATCCAAGTCTAATATGGTGAAGTCATCATTGTATTGGACTCCCTTCAGTGTATAGGTAATACCCACTACACGTTTCATCACTGTTACGGATTCGCCTGTC
GCGAGGCGCACCTTCATCCTCGTTGGAGGGATCTTTCGCTCAACATATTCGAGCTCTCTTTTGTCTAGCGATTGGCTTCGTACAAAGTTGTTCGATGCCC
CACAATCGACTAGAGCTCGAAACGACATGCCTTGTGTCACTTCGAGTTTCAAGGTAATGAGTGAAACCTCATTACCAGAAGCAGCAACACACAATGACTG
AGTGTTGGGAGCAACTTTCGTCAAGAGGCCTGCAAACTCACTTGACGCTGGTGGATCAGTAGGGTGCTCCGCACCTACTGACCCTGACCGTTTTTTGGCT
GTCCGTTACGTTTTTGCGTTTTCGCAACAACGTCGGACCCACGCCTTGGACCTCTCTTGGCCGCTTGGTAGTTACTGTTTCCTGCGGTACGTGATACCGC
GCTTCGGGCACTGCATTCATATGCGTAGTGCCCTGTCTTCTGACGTCTATTGCATCTCTGCAATTTCGTATAGTTGTTAACACGAGAGCTCTCGCTCCTC
GTGTTACAGAGGTCCATTGGTTCTGGGCCTCCATTTTCCTGTCGTCTCAATGGACGATAAGAATTCGAATTCGCGTGATCCTGTTTCACGCTGAAGTCCT
CCTGTTCCGCAACCCTTATTGCCTCTTCTAGGGTGTTGAACTCTATTCAGAACAGGTAGGTTTTAACAGGACCATCAGTCAGACCCTGCATGAACAACGT
AATCAACGTTTGTTGGTTCAGTGGGTCGACTGTTATGCAACTGGTAAGGTGACGTATGTACTGAATGTACGAGTGTACGTCACGTTTACCTTGCTTGATT
CTCAGGAGTTCAGAGCAATCCCTGAACTCCGCTCGAGGCGGCTCAAAAGTTTGCCTTAGCAGGGACTTGAAGACTTCCAACGACCCAAAGTCATATGGGT
CGTGTAACTTAAGGCCCAAGGCCCACGTCTTTGCACGCCCTGCCAAGTTCGATTGAGCAAATACGATCTGCATTTCCTCATCGACGATATGACGAGCCCT
TATGGCATCGTCTAGTTCCACGAATCATAACAATAGAGAGTCTTCATTGGCTCCCTCGTACTTTGAGATGTCAATCTTTAGAGTCTTGGGTCGACGTATA
CACGTCGATCCGGTAGCAGTGGCCTGCTGCTGTCTCAACAGCTCTGTGTGTTGAGAACCTTGTTGGTGAAGCAAGGTTACTTTTTCCCGCTCGGCGTCAA
GTTCATTCTGAATGAACTTGGCGATGGTGGCGTGCTGTCCGTCTGGCCCCAGGGCGGACAGCAGTGCGCCAACGGCTTCTTGCCCTATCGTTGAACTCAA
GCGTTCGACAGCGTCCCATTCGATTTGACTCAAATGGGAGTAGCTTTCATGCGTGGGATGAAAATCATCCCCCTCATCGTCCAACATGTTCATGGTCGTT
GATCGGACTTCGAAGTGCTACCAGGTGTAACGGG