Description :
From Genome Similarity Track
Location :
Scaffold_287:210- 24426
Transcript NameFunction/comments
Phyag_g4322hypothetical protein
Phyag_g4323conserved hypothetical protein
Phyag_g4324hypothetical protein
Phyag_g4325conserved hypothetical protein
Phyag_g4326hypothetical protein PHYSODRAFT_307593
Phyag_g4327hypothetical protein
Phyag_g4328hypothetical protein
Phyag_g4329conserved hypothetical protein
Phyag_g4330conserved hypothetical protein

Sequence
24216 bases(100 bases per row)
GATGGAGGGAAGAGCTCCGGTCTCCGTCGCTGCGGGGGCTTCTGGGGACGCGCCGCTGGTGTCTCCGCCTATACTGGACGAGAGGGAGTCCTCACCTCCC
TCTAGCTTCGCTGCGCCCTCCCAGACGTCACAAACAGCGGCGACAACCGCTATGACGCCTAATAACGGGTCTCCGGTTCATGCAGAGCAGACACCAGCGA
CTCAGCCAATAGCGCAACACACTGCACAAGATCCCAGTACTCCCGAGACGTCCTCTGGTCGGTCAGGAAGCGAAGGCGTGCCGACACCTACAGAGAGCGA
GAAAGGAGGCGAAGCGGCTCGACATTCAAGCAGTAGCGGCCAAAGCGGACAGGTGCAGGCTACGAACGgagagagtgatggtctgAATGGCGTGGAAGCA
GGTCAAGAAACAGGAAAGAACGAGGTGTCGACGCAAAGAACAGGCgatgcagcgaagaagaacacgaagaagcagtgGTTCGAGGTCATCTcgatggtgc
tgcagaattaCAGGAAGCAAGACCGAGAGCAGATCCGACGTACGTTGAGAGAGAATCATTTTCTTTTTTTTACCGAGGATCGTTGACTGATTTTAtttat
tatttttttctGTTGTCTGGATTTTATAGAGCTGGCCACGCCGCAGTGCGAGATCTGTGAACGGCGCAAAGCTACCAAGAAAGCTGAAGTTAGGTGTCAG
CAAGAAGGTTGCGTCCTAGGCAACCGTCCGTTGTGTATGGATTGCTGGCGAGCATCACATTGGTCGACGGAGAGAAAGGAACATCGCCGAATTCAAGCGT
CAAGTGAGTTTTGTACTTTTATAGCTGGGTAATTGTGTGGCTAGACTTATTGGCGCTTTTGGTTTGGAGCAGGTTGTCAACAGTGTCAGATAGATCATGT
TGCGTATTGGTGCGCGGAGTGCGACCTGAAATTTTGCCAGGGGTGTTTCAATCGGATCCATACTGTCGGGAAGACTAAACTTCATCGCAGGCTCGCCACA
GAAGGTTCGTATACTGTTGTATTGCTTGGGACTCTTGAACTGTTGTGAAGAAGTGACGTTgtttttattttattttatttttttattgtgATGGAAGATG
CACCTGGAACGTGTCTGGTAAAATCAGATTGGTCTAGGCCCTTCCAGAATGCGATTATGCAGCTGGTTGCACAGCGAAAGCGCCCACGCCCAACGTTAGG
CAGTAACGAAGATGTAATCGGCGAAAAGCGGAAGcgcgatgttgaagtgattgTTattgacgatgatgatgaccaCGATATGGATGGCGGAAGAGTTCAT
GACTTGCAGCCTGTCAGCAATGGAAGTTTGGAGCCGATGGCAGCTACTGGTGAGGCTACTGTGACTCAAAATGGCACGGAAACACAAAACGTGGGTGTTG
GAATTGCACTTACCCGTCCCAATCAAGCGTTTGCACAACTCCAAGGACCGCCATGGTCTGCTCCTGCGACCTCACAGGCTTCAGGTCCCCATAACTCTAT
GGTGGAGCCGATACCGTTCCCCCCAGAACTTTCAGAAGCGgcatcagcatcaacacCGTCGTCCTCCGCACGGTTCGAAGCAGTACATACAAACTCAGGG
TATAACGTACCGATAATGCCGAACGTAAGCAACGAAGTGAACGTCACCGCAGGTGTGAGCAGCATGCAGTGGGATACCAGTGTATCCCAGTTCTCCgcct
cttcagcatcgatgGGGACTTTAGATGGCAGTTCAGGcttcacagcagcaactatGTGTAGCGGGATGATGGCGGTATCTCCAACTTCTATGCCTGCTTC
CATGAGCACGGCAAGCGGAGTGTGGTCGACAACTTCTGCCATAAGCACAGATTTGGCCAGCATATCCAATCCCAACAACCTACCGCTCGGAGGTGCCGTC
TTTGCGGAGAATGCACTGGTCGATTCATTAGTGGATCGTTACCACGAAGTGAACCAAAGCGTCACGAACTTCGAGCTGCAAACTGAGCAGTTGACAAGAC
ATATTGCTGTCGCAACATGCAAAGGACCGTACGCCGCGGGGCCCTTAATGACCAAGCTGAGTGCCTTGCAACCTGTATTGGAATCAGAACGAAAACGCCG
CGACAAGCTTTTTGTCGCAATGATTATCCAGTCGCACGATATCATGGCTGCTGTGCGTCTTTTGCGCCTGACCGAGCTGGGCGATGTACCGCAAGTGCCG
ATGATAAGCCATCGCAAATGCCTGCAGATATCGAACGAGATCAACCAtcacaagaagaaactgATCGAATTGAACCAGACGCTTAGCGAGACACTAACCC
AGTCGCACGAAGTGAGCTCCTCCTGGGAAACTACACTCATCCGGAGTACGAGCGCTACCATCAAGTCGCATGAGAAGTGCATCCAGAAGTTGAAGAAAGA
CCGCGAAGTGGAGATTGTGCGTATCGTGCAGTTCAGTCGCTACATCCGCGATACGCTCAAACAAACGTTTCAACGGAGTGTGGAAAtacgacgtcagcag
caacaacaggaacAACAGTTTCAGCAGTATGGATAGTTTTTGGAGGACGAAGGAATTCCGCGCCAGCCAACAGCGACAAACTTGAAGAGCGACAATGGCC
TAGATGAAGAGCGCAAGTGTAGGCAAGCTGATTATTTAACGAGGAGTTGTGTCAACCGTGTCGATACACAAGGAAGCCGATCTGACCCAGGAAGAAGTAC
AGCATCCTGCAGGTGACAGCAACCAACTCATGAGGTAAGCCGAACAATTTAAAAGAGCATTACCTACAGCGAGAGTGAACTTACTTTTTGACTTCGTGCG
AAACGAAAGACCCGAAAGACTTGCCCACGATAACGTGCCACGCACCTTCTTGGGTCTCCTCGATCTCATGCTTGATCTGCTGCGCAACCTCCGTGAAGTG
GTTCTTCTCGCCCTTGTACAGAGCTTTGAGTgcgttcgtggcgctggtgagAATGAGGTCTTCCAACTCCTTTGTCGTGTCTTGGTACACGATCCGCAGC
CCGCCCACCGCCACATCGTCCTTCTTTTGAGCTTTCGACATGCTTTGAAGCGGATCTTTCCGTTTGAAAGTGAcgccttcttgttcacgaCGGTTGACTG
CGGAAGACCTAACTAAATCGAGCAACGCTGTGACTGCTAGCAACAACCCAGAACCATGGCAACGACGAAGGACATCTACGAGCATTTAGTGCAGCAAATT
GTGCACGATTTCTTGTTTCGTGATCCCCTCGAGAACAAAGCATTCGCTGAGTCTCCTGTCACCAAGGTTAACTCAAGTAGCAGTACGCTTGGTGAACTTG
AGAAGAGTACGGAGGCGACAATTCACCCGGATTCGCTACTTCATCTTCTGATCAACAATGATACCCAACACGATGAAAACCCTGCTGTAGACGAAGGAGA
CAATAATGCTGACGTTCAACGTGGCTCGTGGATAATGGATTGTACCGAGTGGCCCGTCAAGCGCCTACGCGAAGAGAAAGCTGCTATCAAGCGCTATCTC
ATTTCTCAACGTGCTGCCTGCAAGAAAGCACCGACGTTATCCAGTGGCATCCTGCTCATCCACGAGGCgtacgcgctgctcaagctttttcttctcgaaA
GGGACCCCGACTATCGTCAATTCATGCAGCAATCAATCGGCTGCAACAACTCGTTcgtgacgtcgctgcatgTGCTGCTCACGCTCTACGCGACGCATTT
CGAGCACGCCAACGGAAGACAGGTGCGCCCGATCTGTATCGGCATCATACACGCAAATTGCAGTCTCATATTCACATTACCATCCTGTagatctccaaga
agacCGACGTGAAGCCTGTTGAAACACTCTATGACTTGTTCCTCACTGCgtcagcacagcagcaacagcaatccCAATAACACGAGCAAAAGAAGCCAAC
TTCTTGCTCTGCTATCCTTTTTTACACGTACGAACTGTGAGTAGGGATGATGTCGTCTTTCTTCGAGTCCATACAAGGCACCGAGAGCCACGCGTAGTAG
AACGCCGCGCCTCCCAGCATGTGCATCATCCCCTTCGCGAACCCCAAGGCTGCATGATTCTCATCATtttcgaagaagatggcgataAACCCCACCACCG
TGGCCGCCACCAGGCATCCCACTCCGTACGTAGCGTTCTGCTCGTTCAATGGGGAAATTTCTCCAATTGGAGTCACCAAGCGACGGTAAACAACGCCGAG
CAGGTAGCACACAACCAGAAGTCCCTCGTACAGCGTCGAGTCCCATCCGTCCTTGGTCTTGAACAGCCACGCGCCTGCGAACGCCACATACCGCAGCACG
ATGTTGTGGTTCTCGTCCTTGTAGCCCATCAGGTgcacacacagcagcaggaagtaCGCGACGGATAGAACGTCCGAGATGAAATGCCAGTCGTCTTCTT
TGAGGAATAAGGGCGAGTCGAAAGCCTCggcggcgttgaagaagaaggagatcgccagctgcagcacgccgaTGAACAGCTCGAAGTGGCGCCGGTTGTG
CTTCATCACGCCCAGCGCAGGCAGCATCGCCGCGTCCGTCAGCGCCAGGAACACGAAGCGaccgagctccagcagcattttcctaTGGTCTTGTACAATG
GTGACGATCAAgggcaaaaaaaaaaagtatctGATCCCCCTGTACGTAATTTTACCCAATCAAACTGCGTTGAAGCATGAGCACCTGTGCAGCTGAATAC
ACGGCTTCGTTTTATTATTTTATAGAGGTGATTTGGTTGAATGTGAAAAGGAATCCCGATAGTCGACGGGCTCAGTTACCAATTTGCGCAACGCTTGGCC
AAGTCTCATCACCAAGACAAGAAGCTCCAGTTCAAGCTATGATTCCGACGCCTCTACTACTCGACGGCAAGGCGACAAGCGACGCCGTGCGCACTCaaca
gctgcagccgcaatGCGCCACGTTCCAGGAGAAACACGGCCGTCCAGTGGGACTCGCCGTCGTAGTCGTGGGCACCCGCAAGGACTCGGCCACGTACGTA
CGcatgaagcagaaggcgtGCACTGCAGCGGGCATCACGtcctggaagctgcagatctcattggaggaagaagacggagcGGAaaaggccgaggagaagg
tgacgcGAGAGCTTCTGACTACCGTCAAGCAACTCAATGAccgcgacgacgtggacggcaTCATCGTGCAGCTGCCACTGCCGTCGTTCTGCGACGAAGA
CACCATTCTAGCCACTATCGACCCTaagaaggacgtggacggaCTGCACCCTGAGAACCACGCTAATCTTTTCCAGTTCGCCAGTAAGAAAGCTGCGtca
cagcaggaagaagctccGTTCGCTGTGCCCTGCACCCCTGCGGGGTgtttggcgctgctggatcatTACAAGATTTCTTTGGAAGGCAAACatgtggtgg
tgcttggtcGTAGTCAGATCGTGGGGCTGCccgtgtcgctgctgtgtctgcgtCGCAATGCTACAGTCACGATGTGCCATTCACGGACGCAGGACCTCAA
GGCGCGTGTGCTTGAGGCGGATATCGTCATCGCAGCTATTGGACGACCGAGATTCGTGCAAGGAGACTGGATCAAACCCGGCACGACGGTGATTGATGTG
GGGATTAACCCAGTGGAGGACgcaaccaagaagagcggATATCGTCTTGTGGGAGACGTGGACTTTGACGAAGCGGTGAAGGTCGTGCATGCTATTACTC
CTGTGCCAGGAGGCATTGGACCCATGACGGTGGCtatgctgctcaagaacacTATTCAGTGTGCGTTTCGACGTGTGCAGAAGCAGTAAGTGAGAAAGAG
ATGATCGGTGTTTGGGATAATCACCCGTGGCTCAGCAAGAACAGTATCGATAGTACTTGACTTGTCCGGCCGTGGCTGCTTATCCTAGTTGGTAAGGCGA
CACTCATCAATACAGCGTTCCCTGACCCTGTCCTCACTAAATCCACCATTTGGCTATCTACTAGAAAGGGagatcatcatcatcaccaccgtGTCCGACG
CgcagatcttcttcatcttctgaCGAGAACTGTCCACTCTcttccacgagctgcacgtcTTGGTGCAGTTCCTCCCAGTAGCCTCTGTGTGATTGCTCAG
TTGCGGATTCAGCTCTGTTTTCACCATTGGGACCTGGCTCATCGTCAACGGCGAGGCACGACTGGGCTAAAGCTTGTCTTTGATGGAGGTGGCTTACAGC
TTCCTCCAGCCTCTCCAATGCTGTCTTCTCACTAGCTGGACGGATTaatcgttgctgctgctgctctctcgGTTCACTTGAAGTAGCAGCTCCATATCGA
CGTTGTGCTTGAAGCAGTAAACGCATGCAGTCAAGTTGGCcgtaagcagcagcaatctgtGCGGGGGTCTCCCAGTCGCTGTTCACAAATGTTGGATCTG
CTCCAAGTGACAGCAAGTTGTGCGCCACCGCAGCACGACCCGAAAAGGCTGCCCAGTGCAGTGGAGTGTCTCCTCTTTCATCCGCCACATTCAAGTTTGC
TCCGTGTTGCATCAGCCGAGAAATGATCGGTAGCGCAGCGGGTGACTCTACTGCATAATGCACTGGAGATCGATGCAGGTCGTCGAAAGCATTGACGttt
gctcctcctccaggaGTCAACAGGAACGTTGTCATGGCTATGTCGTGCGTTAGAACCGCGAGGTGCAGCGCTGTTCGACCTTGATAATCGCCCTGGGCTT
GGAGTATACAATTCCAGTCGTAATTCGCTTTGGTAGGAACCACCAACTGCTTCATGCACTCGACGAACCCTTTTTCAGCCAGGCAATGCAGTGGGTATCG
CCCTGCATTATCCGGTGTATGAAGTGTCAAAGCTATCGGGCAAAGCGCTGCAATTCTTTCAGCCGGGATAATGTTTTCAGCGATTGAAtctttcagcagc
aactgctgcaagaaTCCGCAGATCTCGAGTTGGTCTCCGTCAcatgctcgatgcagcaCATTCTGCCCTTTACTATTCGTCTTCTGAATATCAGCTCCGT
GTTCCAACAGTTTCTGCATGAATTCGAGGTGCCCGAGTGACGCGTACAACATCAATGGCGTATCACCATTGGAGTCGACGGCATTTACATCCAACTTCGG
GTCGCACCGGAGTAAGAACTCCAGCATATCAGCTCTGGATCGATAGTTTTCTTTGGAAAATGACAGCATGTGCAGTGCATTGCGCTGCGTCTTCGGTTCA
ACTGCTGCAAAATCAGCACCACGTAGCTGGAGGAAAGTAGCGTCGTCAACTGACGCGTTCTCTACTGCTGTGAAAATGGTCACTTCTTTCTTCGCTCTTT
gtgatggagacgatggtgcAGAGGACCTCCCACTTGGAGACGATGGCACGGACTTCGCTACAGGAGACGGCGGCGTTATTGAGAGCTCTTGGAAACTTGT
ATCTCCCTCCAAGAGCCGCTGACGCCGAATCTGAGCGTGGTCTTGCCCCATTTCACGCAGTAGCATGGCAGAAAGAGGTAGTTCCATTTCCTCAACGTCA
TGATAGCGGAGTTCCGGCCTTGCATTGCCGTTGTCTTCGAGGCAAACTGGAGACAGGAGCGTAGGCATCGTATCAGTTGCGATTTCTTGCAAAACATGCA
ATATCTCCGAGGCCAAATACTCTTCGGAAGGCTCAAAGAGTTCCAGCAATTTACGCGTCATGTGCGAGTCCAGGCGAAGACGGAGTAGAGAGATCGTCCG
ATTGGTGTCTGTCACTGAACCAACAGATCGAGTTGTCTTGGAAACGTCCCAGTCCAACCATGCACTTGCTCGCTTAAAGTAGAAGTGAAAATGCTCGACG
TCCGTTGTTTTATCCGGTCCACTTGGCGACGCAGCCGCAAACGAATGTTGAAAGTAGAAATGCATCTGCAGGCGGCTCTGGCATTCACGAGCAAACTTTT
GGAGCACACAAGCTGCCTTATGGCAGAACAAAACCTGGTTGACACCGCGCATAAAAATATGTGGTAGCTCTCGGTGGGTCCAGTCGTCGACTGTCGTCTC
CACACTTGCACGAGTTAAACCATTTTCCGGTGGTTCCGATGACAGTTCTTGGGCGTCACCTGCAGGCTCATTGTGTGGTTGGTTCACTGGGTTTTCTTCA
CGTTCTTTGCTAGCTAGGTCTTGGTGGTTAGTCTTGTATTCTTTTTCATCAACCACTCTGAGCGAGACACCTTTAGTAGCAAGCAACTTCCTTCGAGAAA
ATAGGGCTCGTTGGATTCGTTTGGCTGCCAACGCGCGTTTAGCCGCAATCGCGTTGCGTTCAAGAATTTTTGTCTCCTGGATCAAACGAAGTTCTGCAGC
TTTGACCAGTGCACGCCTAGCCTGCCGCACACCCTTGCGCCATTTCCTCCAATACACCTGCACTTTCGTCGCGAAAACTGACAACTTCATTTGATAGTGG
CggacttcttcagctcgtttCATTTCCAACACCTGTAAATACTGTGTCCGGTACAGCTTTGCTTTCCAGATCGCCTCGATCTTAGTCGCTGCACTCTGTT
CACGTCGATTTTGGAGATATTTTCTGACAGCACGAACGATACGCTTACTGTGGGATCGGTGCGTGATGCCATCCAGCTTTTGCTGGCGGTCTTGTTCCAG
AAGTTGGTTTGCGTCAGGCTGCGTTTCTGCAGTTAAACTACTGCGGTGTTTCTGGGGTTTAGCATCTTCGATCTTTTTTGTGTGTCGTTGTTTAAGACGA
AGgtgtcgccaccttctccagtgtTTTTGGATTTTGAGAGCGTTGATGTTTTGTCTGTGCCGCAGACGCTCCTGGTCCATCTTTCGCCGCTGCTGTGAAA
TTCCCCAGCTCCGTTCGATCTTGAAAGAGCTTTCGTGTTGCTCCTGTTGAATGCGTTCCCTCTCAAGCTCCTCCTGTTGCTCATTATACCACTTCAGCCA
CAGCGTTTGGATCTTGAGAGCGGCCATGTGTTGTTCGTGCTGAATACGCTCACGCTCCATTTTGCGATGGTGTTGTCGTGCTCCCCAGTTCCGCTGAATT
TTCACTGAGCTTGCATTTTGTGTTTGCTTGACGCTTTCGATCTCTTGCTTCTCTCCACGCCTTTTTTTCTCCTTGCGCCAAAACGCTTGGATTTTCAATG
CATTCGCAACGTactcctgctgcagacgttCATCTTCTTTCTGTAAGCTCTGCTCtttctccagcttcaccCGTTCCTCTTCCCTCAGGCGTCGAACCTT
TCGCCACCAGGTTTGAATGACAAGCACAGCTGCAGTCCTGTGCTCTTTCCGTGATCTGGATCGTTTTCCTTCTTGGACGCGATGCCACCGACGCCACTTC
CGCTGAATTCGTTGGGCTCCAAGACCCTGTTTACGTTGAATCTCTTCCTTGTCTCGGCGAACACGTTGCTTTGTCCAATTCTGCTGCATCCTTAGCGCGA
TCGCACGTTGCTCTTTTTCCTCACGTTCTCGTTCTGCCCGCTCAAGTAATCGCTGTCTCCATTGTCTCCACGCTCTTTGAATCCGTTTCACAGCGCGAAT
CGCTTTTCTCTCCTTTAACTTCCGCAGCCACCACTGACAACAAGCAATTTGGATCCTCGCCGAGTTCAACTGTCGTCTACGCCGCTTTCTTGCCTTCTCT
TTCTCGTACTTCCGTTTACACTGCCACTGACGCCAACTCTGTTGAATGCGTATGGCTGCCAGTATCTGCGTGTTTCGTACACGATCTGCTtctctcttct
ccttctgccACTTCTCCCAGCATCTTTGTATTATCTTGGCACTGTGATTTCGCCTTGCCTCTCGTCGTTTTCTTTCTCTTTTCGCTAgttgccatcgcca
ccaactcTGTATTCGGAGAACACTTACACGCCTTCGCTCTTGCAGTTCTTGCTTGCATTTGACACACGTTCTCCACGCTCGTTGAATTTTACGCACGTTG
GCTCGAGTACGAATAACTTCCAGCCGCGCCTCAAATGCTAGTTTTTGTTCGTGTCTTCGATCTCGCTCGTGTTGGACCCATTTCCTCCATGCACTTTGGA
TTTTACGAGCGTTCACCCGTAGACGTATCGCTTCGAGCTGTTCTGCAAAAGCAATTTGTTGCAGAAGTTTTCGCTGCCGCTCGTGTTGaatccagcgtcg
ccatgcTCCTTGAATTTTTCGCGCATGAGCTCGAACGCGGATTGCTGCAAGCCGTTCTTCAAaaagctgttgttgctgttgtcttTGCTCTTGGTCGCGT
TTCACCCACTGCCTCCAAACTCCCTGAATCTTGCGTGCATTTGCTCGCCGTCTTACCGCGTCTAACTTAGCATTAAATACAAGCTGCTTCttttgccgct
gctgttctcgtcgctgctgctgcttgtgggcACACTTTCTCCACCAAAGTTGTAGTCTTCGCGCTAAATCGTGACGCCATTTAGCTTCTTCTAGATAGGC
ACGTGTTAGCTCCTGTGCACGCTTGCAATTCTGGTCATGTATCCATTGGCACCAACCTCGTTGAATCTTCCGAGCACAATTCATATTTCGCAAGTGCTTC
AGCCTCGCAAATTTGTGTCGGAGAGCTTCGGAAAACTGCGATACACGAGCAATACCCTGACTGATGCCCTTGTTACACTCGCACTCAGCCAGAAGCTTGA
CGTCGATAATAAGTTGAACTAACTGTGCTCGAGTACTCCGTGCAATAGCTTTCTCTTGGACAGACTTCTGATGTTGCTGTAGCCGTATCATCTCCACCGT
TTTCTGATTACGACGCTGGCTAATACATTGATGCATGACGTTAGAAGCTTTGATCGATTCGACTTCGTGCATTTTCGCCTCGATCTCCTTTCGTTGCCTT
TGTTTCTCGTCTTCCATCtcacgagctgctgatgcacGGAATGCCGCTGCTTCCTTCTTGAATTTTGAAAGCTTCATCTGTCCTGAAGCCCAGGAAGCTA
TCGTTTGCATGCTGGCTTCGACTTTACTGTGCCTCAaagccgcagcaacttgctgcgcttcctgttCTTTTTCCACCACCAGTTGATTATTCGCAGCTAA
CAACGCATCAGACTTCGCTTCCAGCTCAGACAAGCGTTGATGAAGACCAGACGCATTTGATATTGCTATTCGAcgctgctcctgctgatCTTCGTTGGAC
ATGAGCTCGATCTCTGCTTTTTCTGCTAGCAAGCGTATTTGCCCCAACAAGAGTTTTCGTCGCTCACTGTCAGCTCGTCTGCACAACACCCGTGCATCAA
TGAAAGCCTTAATCTTATGTCGAGCAACATGCTCTCGAGAATCTCGCTCTCGACCTCGGTGAGCTTCAACGATTTCTCGGTGTCGAGTCTCCGTCTGCAA
CGCCAGTTGTGACATCCGACCTAGTTTGCGTTCCAGCACTCGAACTTGAGTCCGAGTCTGGCTAACCCGCTTCTGGGCTGCAGTATCCAGCTTTTCTTTC
GCATGGAGTTCGTCACGAAGCTTACTCTCAAGATATTTCTTCTCCGTCTCAACTTGTTGCAGTTTCTTATGAAGAAGACACACTCTGAAAAACATTTGGA
TCTTCAACGCCGCAAGTTTTCTTCGGCGCACTTCAACAGTatattgttgctgctgcacgacacgTCCATGGTGTGTCAGTAGCTCCAGTCGTTCTTCCTC
TGACACTTTCCACCGTTGATCGAGGTCGGCCAACTTCTCGTTCATCTCAGCGATCAATTCTCGACGATGCTTAGCGTTGAGCATCATGGTCCTCTTCATG
TCTCGCTTCGCCTTCGTCCACTTTAGTTGCTCCTTGAACATGATGTTCTTAGTCATCTCTTGCGCGGCTTTCAGCTTGCGGCGCAGTAGAATCTCTTTCA
AAAATCGCTGAATATCACGCAgagctcgtgctcgtctctctcgttctcgagcaAGTTTTTCCTGAAGTCGCTTTGCCTTCTTAATTCTGAGGCGCTgacg
tctccaccaccgcacCACTTTATTCTTTGCAAATTCTCGCCGGGCTCGCCGTCTCGAAACGCCCACGAAGAACAGCGCGCGATGGAATGCCATGTGAACA
GTTTGAAAAGCACCTTTGCGTTTGACAACATCCTGGTTGTGGCAGTAGATTCTCCAATTTCGTTGTAtgcgtgaagctgccagACGTCGAAGACGGTTTT
CTTCATCAATTCGAGCTTGCAAGCGTCGACGATGGTGATGCAGGATAAACCGTCGGACTTTCCGCCGTGCGACTAATCTACGAACAACCAGTTTTGCTCG
CTTTTGATCCACACACCACACTTTCCACGATGCAAAGTTCCGACGAAGCATCTTCAATTCTCGTTCCAGATATTTGGGAGCATTGTCAGCCTTCGTATTT
GCTGTCGTGGGCGACGAGTAGCCCATCAATGACGAGAACGGCTGGGCTACAGACTGAATATGGTCCTCGACCTCTCGCTGGGATACCCAGTGGCTCATGT
CATAAGCTGCCACTTGGATGTCTCGACAAAGCGCGAAAATTCGGTGAAATTCTGATGGATCACCCTCATCGTCACCTTGgtaacttgctgctgatatATT
GCTACGCGATGAAGCAGGTGTAGAATGTACCAATTCGTCATACGTCACCGCTGCAATATCATTGCGAGATGTAGGGGGTGACGACGGTATCACTTGAGTG
GTCATCGACGAAGTACTACGAGCTGAAACCGGGAATGAATTTGCCGTTCTCCCTTTGACCAGCGATCGATTATAGCTACGAGACGAAGCTGGTAACAAGT
ACGAAGCTTGATCCCCCTGGATATTGGTacgagctgaagatgacATATCCGTTGAGAATTCCGTACGGCTGGTCATTTGCCatggttcttcttcatcttc
aattGAACGGAGTGTGCTGACTCCAAGAGAATCAATATCCACTTGAGTTTCAGGCTGATCGGTAGGAACGGAATATATGTCGTCTCTCCGGACACTTGGT
AGTAGACTGAGAGCCATCGCAATACTGGATGAGTACGTATattcgtcatcttctccttctgctgggGGCGTCTCTGTTCTTTGTTCGACACTTTTCGGCT
GGCTTGGTACACTTTCGCCGGCTTCATATTGCGTGGTTCTAGTGGTCTGTGAGATAGTCACAATTGATTCGACAACATTTTCAATTACACAGGCCTCGAA
TGATTCTGTCCTTCGCGTCTCCAACTCGGGCTCAATTGGTGGTACAACTTCTTCAGGCTTCGAGACTGCATCAGCTAGAGAAGCCTCAACATTAGACAAT
GAAAAATTTGGCAGCATCTGCAATGCCATCGCTATACTAGACAACGCTTCGTTGGATGAGTATTCGAAATCATCTTCGTATCCATCATCGTTAGTCGCTT
CAGCCTCAGCATTGATCCCCACCTCGGAGATTTCAATCACACCACTCGAATCTCCGTTGATGAATAAAGCTGGAGTTTCTTCCCGGGCAGAATGTGGTAG
CGTTTCTAGCTCCATGTCATTCATTGTCATCATCACCAGAGGATCCCAACCATCTCCCTCAGTTATCGACGCAGGTGATCttgccactgcagccacttcC
CTGATCTCTACTCGGGGGTCTTCATTAGCCATAGCCTCAACGTTTACTTCATAATCCTGGATCGCCTCATCTCGTATTGACCCCGCTGAAGTACTTCTCA
CTGACACCTTCGTTGTCAGAGTTTCTCCGTTTTCGATAAAACTTTCTGTCGATGTCCTTCGCTCACTCACGTCGACGAATGCACTGTGCTCATCGCTCTT
GTCCTTGGCTGCTctgcttttttttttcgatACAGATCGTCCCGACAAACTGCTTCTGTTTGACGTtttcgctgttgctgccgtgtCTAGCATGGTAAGT
GGTAGCTCCAGTCGAGTCAATTCCCCGTTGTCATCGCTTCCAGATAATTTTCTTGACGACGGCAAGGAAGTATTCTGCAGACGCGGATCAGCTACTGTCG
AAATTATCGTTCTGGTTTCAGATTGCACTGGAGGATTTGCTGTTGGTGAACCTGCCCACGCTTCCATTACCGGCTTTTCACACATATGTGGATTATAACC
ACCTGTATGAATCGCTTGAGAAGCTTGACGATCCAACCGCTGTATCCTTTTATCTTGGAAAGTACCATAACCGTCCGAAATGCCATCTAGTCCACGATTt
tggtgaagttgttgttgatacAAGTAACTTCTGCTGTCATTGTGCGATTGAAGATACCTCGGCAGCATTCGAACAGCATCTAAGCGTGTTTCGAGGTCCA
TCAAGTGCAGTAAAGCCGCTGCTACTCGTTCTGCTGGTAAAATTTGCCATCCCGGGAGGTATCGCTGAGTCTGGAGAGCGAATGTTTCGAGCTTTTGAGT
CAACAATCGCAAAagtgaggaggaagaggtaGAAGCTGAACAAAATAAAGCACCTGACGGTGCACTTTGATGACAGGAACACAGCAAAACCTCCGACGAG
TCCAAAGATAATCCGTCCACAAACGGATTGCGAGTTAAGTTCACCTCAAAGTCTTCAAAAAATcgctgcagtggtggcgagCACGCTAGAAAATCCGTGT
CAGACGACGCCATTTGCAGCAAGTAGCCGTAAAAATCCTGCTCCAAAATCTCATGCTCGATACTAACGCCAGCCATATTCGACTCGCCAAGCTCGCTGCT
CAAGTACACCACTGCTTCCACCACTGCAAGTGATAGACTGCGCATCCtgttcaacaacttcactACTCGTTGCGGAACATTTTTCTCCACGTGAGATGCC
CGGTGCAACGGCAGCACCCCCATTAATTCCTGCTGCACATGGGCAATAACTTGGTCGCGTAAGTGTATGTTTTGACGGACTGAATCGATCACGAGTTGAG
CCGGTGACGGGTGCACTGGTGCTGAACGGACTGCACGTTGGGCAGAGCCTCCACTGTGCGGTGATTTttgttggtgacgatgggGTGTCGGATCATTTCG
AGTAcccagcacctgctgcttcagcttgtACGGACTTAATAGGCGCTTGGCTTTGTGGCGCTCGGTAAGTGATTTGGTCACTGCATCTCTGGACTGCAAC
CGGGGCTTTGGTTCAGTGATGAAGCCTTGGCTATAGCTAGGTTGCATCCTTGTGTCCGCTGCATGAGTCGCTCTCCTAACTGACGCAGCAATTCCCGCTT
GCAGGGTACCTTGGTACAGCGAGTCATCCAATTCGAGCTCCACCAAAAGACGTTGTTGGTCGTGGCGTCGGCGGCCGCTTTGCTCCGTAGCTCTGCGCGG
TGgcgcgcttcttccaccCCACAAGAAGGCTCTGTCAGCCATGCCCTTTAAAATTAGGAATGTTGCGCTCACACTCGAATTCCACCAGGACGTTTCTTGA
AAGCGTTTCGACAAATATGCTGCACCAACATATCAACGAGGTACAGAGCTCTAAAGACTAAGTGCTCTTAAGATTTACCTTGGTTCCAATTGCAATGGTG
ATCGTATGTATCATACCTAGATAAGCAtatcgtcctcctcctcctcgccgttCGTTACAGTTGTAAGGCCCTGGGCACGGTACAGATCGGCAATCTGCAT
TCCACAGCAAGCAGTATTAAACATTAGTCAACGGTGGTCTCTCAAGaaaataacaacaacaaacgtACCTGAGAAGAGTTGGTCGCCTGCGTGGTCTCCT
TGTCGTCACGGATGCGAATAAAGCGAGGGAAGCGCAGCGAAATACCCTTGTCCTTCGCCACAAGGCCAATTGCAGCCGTGTACTTTGGCGAGATCGACAG
GTCCGCACCTAGAATCTCCCACACGCAGCTCGCCTCGAACCAAACGTCAGGTTTGATTCCTTCACCGACAGCATAGTCACTAGGCGGCTTGTCCAcaacc
ttctccttcagttGGTCATAGAACTGTTTGAGCACTTCATCCGACAAACCAGTTCCCAGTTTCGTAATGGGTTGGTACATTTCGGTGTCCGGGTCGTAAC
AAGCCAGCAAATAAGCGCCATAAACTCCTGTGCGCTTGCCGCGACCGTGGAACGCACCAATTGGAACCAGGTCAGCTGAATCGCCAATGCCATCAAGGTA
atccttcttcagcttcagccacTTGTGTGAGCGGTTAGCCGGCTCGTacgtcgcctccttctctAAGGTTTTCACCATCAAACCTTCGCAGTTCTCACGC
ACAGCCTCCTCCAGGAAATTGCGGACCTtatcaacagcttcttccatCGCTTCCGCGTTATCCTTCACGTCAACACCATCTTCAACGTCTAATGACGTAG
CGAATTCGAAGGTGCCAGGCTTCACGTCGAACATCTCGCGCAGCTTTTCACGGCGTTTCGCCAGTGATGTGCCAAGGAACGATTCCCCATTCAGGAACAA
CAAGTCAAACGCGTAGATGCACACGGGCACCTTAATGTCCTCAACTTTTACGTTCTGTAATCACGATTCAAACAGCATGGTTAGAAGAGGTGAACGACAG
TGAAGTGCTAACGCAATAACCGCGTACCTTCCGAGAACGCGTGCTCAGGATCTGGAAGGGCAGACGCTTGTTTGTAGCTCGATCCACTGCAACCACCTCT
GCGTCAACAATGCAACTTGTAACAACACCCTTCTTGGCAGCGCTAGAAATCGCCAGCTTAACGTCAGGGAATCGTTCCGTAGAGTTctcgaagttgcgcg
agAAAATAGCCATTTCTCCGTTCGGGAGGATGTGGATTTGAGCACGTTCGCCATCATACTTGTACTCGCAGGTGAATGGTTTACCTTCGAAGCGGTCGAA
CACCATTGCGTACGCTTTGGTTGGGCGCGCAAGCATAGGAGAcaccggtgttcctggtGTCAGCACACACTTTTCGGCAACCTTGGCAAAGTCCTTCACG
CGAAGGAAAGGGGCAGTCAAGATCTCCTTCTGGACCTCGTAAAATGCTGCAACCAGAGCGTTGTAGCTAGGGCACTCAGCGAAAGCCTTCTTGACAAAAG
CAAGCGCCTCCTGCTGTTTGTCCTTATCCTTGTACTCCTTGTCCGTCATGAAGGCGTAAGTCAACCCCATAAGGATCGATTTTTCTGCGAGACCAATCCG
TAGCTTACCTTGGAGCCCACGAATGATGTACTTagctccttcagcagacTGCGCGTCCTTACCTTGAGacttcttttccttctcgcACTTCACCAGCAGA
CCCTTGATAATAGAGCACTTTTGTTGTTGCGAGTTGTTTCCTGTCATCTTCGCAATCTTGACGAACTGGTTGTACACATGCTGAACGGTGAGTCCACTAC
CCTTAGAGGACGCGGGGGCAAGAGACGCGAacgacagcgtcttctgctttGACCGTGCATTCTGAGCAACCTTACCGAGATCACCCTCTTTGTGGTACAT
CTCCTTGATGAACTTGAGGTTCGCGCCAGTTGCCTCGCCAATAGCTTTCATCAAGATAGCATCGCCAATGCCAATCTTCAGGTTCTCAAAAGGTGGCGCC
AGGTCGACGCACACGCAGAGGTAGATGCAGGACAGCAAATCGTCAGGTGAACGATGAATGACATCGCGGAAAAACGCCGTGAGCAGGTCCTGGATGACGA
GACGACCAGTAACTTCCTCAATCTTCGCGAACAAGTGCGCGAGGGCGAAATAGGGGGTCTCTCGGGGTTCGTCACTGTCGTTTTCCTTGTTTTCACTCGC
ACCAGTCGTCTCCGCCGCCGATTCAGGATCACTCTTGATCTTTTcatccttcttgtcgtcgactGGGGTCGACTTGgccttgctcttcttgttaGACACC
GGGGCGAAGAAGGCAGTCTTcgacgccgcagcttctttcttcgtctccgtcttTTTAGTCTCCTTCTTCGGCTTAAcctcttcgacttcttcaatCTCGG
TAACCTCTTCAATCTCcacgtcatcgtcgtcatcgtgaTCTGCCTCAATCTTCTTCGGACTAGATTTCTTCTGaatcgtctccttcttcggactcttgct
cgtcttcacAGGCGTCTTCGTCTCTTTCTTCTTAGGACTCTTGGCCTTTTccggcgtcgacgtcggcgaTGTAATATCAatcacctcctccgtcttAGTA
ACTGTCTTGTTCGCCGTAGtcatcgccagctccagatcactgtcttcctcctcctcctccacaacCCGTTGACgcaggcgacgacgaccagctGCAACAA
ACAGCAACGATAATAACAATAATTACTATAACATCCAACTGTTGGCCATAGTAAAGAGAGAAACAGCCACGCAcgcttcgtcgtgctcttggcttcctcc
tcctcctcctcctcttctttttCCTGCATCTCCACATCCTCtggctcctcctccacttgcttctccacttcctcctccattttTTTCGTCTCTTTAGCCA
TTTTCGGCTTCTTCACTGGCTTGACGGGGGACGCAgccgtcttctccacatCATCTTCTGCAGGTTTCCGCTTctttggcggcggcgtcgaagcCCCAGC
ACCGAAAAACGCCCTAAACCAACCAACAAGATAAACGTTTAGAGCGAGATACCTAATGGGGTTAAAAGCTGCTGACGTACATAATGGAGCTCTGTCTGgg
cgcagctgcagctagCGCACACACAGGTTGAACAAGTTAGAGCGTGTTATATCGCCGTATCCACCGCCACAGCCCCATTAGAGCCGCACctttcttcgcc
atcgtaaCAACAGCCGAGCTTTTTCCACTATTGATCAATCAACCCAAATTTGGCGCCAAAACAAAAATGTACCCAAAAACGAAATCGTATTTCGAAATTT
AATTCTAAATTAAAATCAAATATTTTTGGCGGGAAGCGCAGATCTTGAATTATAGCCCTTTGTGTCAATATCGATGGGCCGAAAGCTACTCGCGCTCGTC
CCGTCGGCGCTGCCGTCCGCCGCCAACTTGGAGCGTTTCCAGCCTGACGCGACGGACGCTCCGCTGCTGAGCGTCGTGTCGTGGACCTGTGGCTCGAGTC
GCACGCGTCAATTGGCTCTagacaagaacaagcagcaactattggagctgcagcggctgcagcctGTGGAAGGCTCGCGCAGCTGGTTCGTGGGCAATTG
CGTGCTGCAGGACggaggagtgatggtcttcTCGCCCATAAACCCACtttttgtgctgctggacgctgcgTGGGCTCAACGcagtcgcttctcgtccgtt
TACGACCTTCTGGCGAGTGTTAAGAACAGTTGGCTGTTGCAGCTttcgacgctgaagaaggaggctATTGAGAAGATCTGCGACGTGCAGCAAGTgggcg
gagaaggagacgaagggGTGGGGGATCTCTATGTGAAGGTCAATGAGAGCAAAGCGACGCGTTGGTTAAAGGCGAAAGTGGAGAAAGTGGCGGCGGTGTT
GGCGAAACAGGAGCACGAGGCAGCGGATAAAGCTGCCGATGCAATGGCTATTGATGATCAGGTGAATTTGCCAGGATACAAACAacaagagaagaagaaa
aagaatGCGGAGGTGACGCAGGAAGATGTGACTCGGCATTATCGACCAGCTATTGATGTTGTCGGGGACTATTTAGCTGAAGAGTGGATCGACCTGCTCT
GCAAAGAGTTCAAGTACGTGTTGTGTTGTCTTGTGTAGGTGGGGTTTTGTGTAGGGGAGCTAAGGTGTTTTGTTGTTTTGTTGTAgggtggagaaggtgg
tggaggtgaagaTTGTTGCTAAGGCttcagcagctggaggaccGCTGGATACGTTTAAGAGGTTTGATCGACGTCAGACGCCGGAGAACGGATCCAAGCG
CTCGACGCCTTCTAGTGCGAGTGGCGCCAATGCTAaaaagaagagcaagttggCTAATGTGGATCGGACGGGGATGAAGTCGCTTACGTCGTTTTTCGGT
AAAAAGTAGAGCAGATTGGGATAAAGCGATGCATTGTAGCGAATATATAGAGCTGTTTATCGTCGTGAGGTGGAGCCTTCCACGCTGACCCGATGCACTA
CCACGAAATCGTCCCAGCCGGAAAGGATCTTGAATttgatgaaggaggcgtCAGTCGGTTTAACATTCTCACTAACGATCTGCACCTCGCCGTCGGTCTC
CTTCAATTCTGCCAGCATAACAAAACAAGGTTAGTCTGATGGGTAGCATCGAGCAAAGCTGTCTGCTGGCGCTTACTTGTATCAAAGAGCTTCTCCCACT
TCGTAGGTGTCGGGCCGCTGCAGGATTCTACCAACACCTCCTTCACGTTTCGAGTCCACATCTTAGCACGAACCACAGACGCCGTCGTTGCCAACTGGAC
TACGATTTCCTGCGGGAAACTCCCTGTTGTCACCCACTTTGACGATTGCCCTCTGCTCAACACAACGTGGACAAAAGCTCAATCGCCAATTCGTCCAGGT
TACATGAAGACAGCATTTACCCGTCCAAGATATTAACCGGCGGATAGACCGGATCGTATGAAGTCACGGCAGTCACCtgagctccttcttcatccaaaGC
GAGCTCCatcacaacaacaacgacagcggcTGAAGGCTTGTGGCCTTCCTGAACTTCAGGCTGAAGTACTCAAAACTGCAACGCCTTAACTTAGAAAACG
GCACAGCACCAAGTAATAATAGCAGAACAGACTCATACTTATCATCTCCATTCGGCACAGAAAATACTGCGACTTACTTGAACACCCTCCTAAATACCAA
CGTCATAGATGGCATACGACTCCATTGGCGCTGTTAAAATCCACTTCAAGCCGCTCCAATGCGCCGCCGTGAAGAAATTTACCAGCTCCATCCACTCGAC
AGTCAGCAACCATCTCACGAAGTCAACGGTGGTGCAATGGACTCTTTATACAGGCGTTCAAAACCCGCCGACAGAATATCAGCTGCACGCGTAATACCGG
ATCCGTCGTCATTGAAAAGCTTGCAGTTCGACCACATCAGCCGAATGTCGTTAGCGAAGTGCGTCGTATCCAACTCCTTCACACCGGCCGCCACTGTGTT
GCTGTCCACGATATATGCGCCCTTCTTCAATTTGTTCTCGATCCTCGACAAATCCATCGGTTGTTTCACCACCCGCGTGTACATCGGGACATTTTCCACT
GGTGTGAGGAACGGCTTTGAAAATGGATGCGACTTCAAACACTGGACAATTTTCAAGCACTTGTCCAACAAATTTTGCTCGGCAGCCACTGCCACAGAAT
ACCCCTCGAACCGCGACGGTTTCTTGCACTCAGCGCACTGCCAATCGCCCTCAGGCAGATCATTCTCCGTCATGTGCAGGCACTTTAAGTGGAAAGAGCG
CGGGCATTTATCGCAGCACACCAGGTCACCAGCGCCCTGGCAAACCTCGCAGAAATCTAAGTTCGTGTCCAGTTCGCTTTCTGAGCcaccttcctcttcg
tcttcatagtcctcgtcgtcttcctccttgtatacctcgtcctccgtctcctcatcttcattgATCGGTTTTGGTGGTTTAGCGTGTTTAGGAGGTCTAC
CTTTTCCCCTCTTTACAGGCTGGATAGTTTTACGCTCTTGGGAGCTCTTTGACGCAGCAGCCGTATCAGTATGTATCTTGCGTGGACGCCCTGGTCCACG
atgtggtggcggcggtggcggctgCGTAACATGGCTTTCCTTTTTATCAGTGTTGGGTGTGCTTTCCGCTTCAATGCCATCTGACTTCGAGCTAAGCTTC
GTGCTTGTCTCGAATTGGTGTTTGCGCTGATCTTCGTTACTCTGTTCTTTTGCCAAGCTTTCGTCACGATGCGCTGCACGAGAATCATCTCGTGATGATA
AGACGCCGGAGTCACGTGGCGCCGGACtatcctcgtcatcgctttCACTAATTTTCCGCTTCCGTGactggagctcctcgccgGATCGTGCATCGGCGTT
CGAATCCTTCCGAGGCGTGCTCTCGTCACCGGAGTCCATTGAGCTAGTTGGTGATTGATCCTGATAGGAAGCATCGGATTGGCGACGCTGATCAGCAATG
CCACGATCAGGGTGCACCCGAGGAGATGCTTCCATTTCAGTATCACCAGTATCTTGCTCGTTTCCACTACTTCCATTCGTTGCTGCATTTCCATCCGTAT
TGTAGCGCGATTCACTTGGACGGTAACTGCCATCCTTACTCGACTGGCTGCTAGCATCCATTGCCACCGAGGTTGCGGGGGCTCCACCTTGATTTAACGA
GTTCAACAACTGGACCAGGGATTTCTCTGACTCGGCACAATTCATAACGGTCGCTGCTGACGGTGATTCCGCAGCGCCTTGGTGTACTTGAGGCGAGGCG
GctctggcagcagcaactcgagaaTCAGTAGCAGTTGGCGCGTTTTCAGCGACTGCAGAGAACGTATCAGCAGGTGTGTCCTTTGCTGCTCGCTTTGGAA
CGGGAGGGTACTGAGACGGTGACTTTTGCTGCGCTTGCATACTGGGAGAATAACCATCACGAGAGTTTCGTTCGCCCACAGGATACTGCTCATATTCGGA
TTGCTGAGACGCCACTTGTCTGCGCCCACCATACATTTTACTTGCCTCGATATTGCGAGCAGAAAATCCGTCACGTTGAATAGGAGGTCGCCCTTCCGCC
GGCGGTGTACGTGGATACTGTGAATATCGGCGGCCGTCGCTACCACCCACATTTTGAGCACTACCGTATGTCAACCGTCCTTCAGTCGTCGGTGTAGCAA
CAGTAGTCAcaggaggcgcagcagcagcagcagcgcggccATCCCTCATCGCACTCCCTGAACCTTGTCCGCTACGACGCAGCGTGTCCATCAGATAACG
TCTGTATTTCTGAACGTCATTCTCCTTTTCTGCCGTGCATCCCGTGCACGGACATCCACGCGTACAAATCAagcagcgcagcaagcgTCGGTTAGGAGCC
GACCCGTTCCTGCCGACAAATAGTGCCTCCATTCTAACCCTGTACACGCTGCGCAGATGCTCTCTACACAGCGAGTGGTTCTCGTCTGCATGCGGGCAAA
AGTTCACCACGGGCACAAAATGGTTTTCGTTCACTCCGCATAAATGGCACAGTCCTTTTGCCACAAAGTTGGCTTCCTGCTCCGGGATCAAGTCTTCCAT
CGCCACTGCAAACGCATCATACATCACGGAATCGTCCATATTCACCTGCTCGCGgagcatctcctccactctCGGGGGCAGCTTCCTCTCCCTCTTGTAA
TCCTCCGCCATCTTCCCGGAAGAAGAGCCCTCCATCGGTCTACCCTGATACATCTTCCCAGCAGAACCGTCCATCACTCTCTGGTACCCTGCAGGGACCT
GAACAGGTCTCCCCTGATATCccccagccgcagcagcgtcgaccGTTCTACCCTGGTAACCTGGCGGTGCCTCCATCGTTCTACCCTGATATCCTGTCGG
TGCCTGCATCGTTCTCCCTTGATACGCCGCCGAAGAGCCCTCCATCGCTCTCCCTTGATACGCCGTCGAATTCCCCATTGCTCTCCCCTGGtacctcgct
gctgcttccatcGACCTTGCTGGGTAGTTTGCACCTCCATTCATCGTTCTACCTTGATATCCCGCAGCGTCCATAGCAGCGCTTCTCCTCTGGTACCCTG
CAGCACTGTCCGTCATCGTTCTCCCCTGGTACGACGGAGGAGGGCGTTCTACCGTTCTCCCAGGGTACCCcgccgaagatgatgaagaagaagaatacTG
CTGATACTGCATCGGTCCTTGACTCGGCGCCGCTTGGTCCCAGTCCCGCGTTCTCCCCTGCCACCccgctgacgctgacgacgtGGCTGTAGCCACTCCA
CTGGCTGCCACAGCCGAGGCAgggatgtagccatctggcGTCTTCCCTTTGTTCATGAGCACTTCCATCCACACCTCATTGGGCGTcagtcgctgtcgct
tcTAAATGAGATTAGAAATGAGATAGAAATACCATTGTTAGAGATAAGGAGGGGGGAGGGGGCGAGCACGGAGATGCACCTTGTCTTCTCGGTCGCGAGC
CGCCCCATGGTACATGTTGCTTGAGGCTTGGCTTGCTTCGCTCGGGGCGTGAGgctccttccttccttcctccCTTCCTTCTTGCTTGAGATTTGTCGTT
AGCACCACAAGAGACAGAGTGACTGGGGACTTTTGGCGCGATTAGGTGCTGTGAGAAATGATATATCGAGCAACGAGATTGAGATGAGGATGCGTTTGTA
GAGGTACCCATCGCAATCGGTGCCTGGGATTACTGTTGCCTCCTTTGGTATGGTGTGTACCAGGTGCCACCATCAGCATTGCTGGAGCACAAACTGCCAC
CTGGCAGCATTTCTCC