Description :
From Genome Similarity Track
Location :
Scaffold_390:210- 2144
Transcript NameFunction/comments
Sapdi_VS20SDRG_17448hypothetical protein

Sequence
794 bases(100 bases per row)
CCGTTGCAGCACTGCGCGACCTGCGCTGCCGTGTCGCCGTTGACGCCAAAGCTGCGGATGTCGTTGCCGTAGTAGTCGACGTCGGTGCTGACGCTGCTCC
CGCACTGGCTGGACGAGCCCGCAGAGGCGCCGGGCGCAGAGGCCGAGACGACGCCAGCGCGGGGCGTCGGGCTGCCGAGCGTGTGCTTGAGCCAGCACAC
ACCGCTGTTGATGGAGAAGCCGGCGCAGCCGTTGGTCGAGCTGCACGCCGCGCAACACTGGCTGAGCTGGTCTTGCGCACTGCCCCACACCCCAAGGTTC
TTGATGTCGTTGCCGTAGTAGTCGAGGTCGCTCTTGGCGTTGGCGCACTGGCCGCCGCTGTTGGGCTGCGGCGCGGGCCCCGGGTTCTGGCCGTTGCCTT
GCAGCGGAACGCAGTTTTCTACGCACAGTATCGCAGCGTGAGCCATGGAGCCATAAAGGTCGTGGGACGCACTGTAGACTTGCCACTCAGGCTGGTGTAG
CGCAATCCAGTAAAAGCGCAGCATGCAGCCGTCGCCCGCGCAGCTCGAGTAGTCGACGGGGAGGTGCGCGGCCGGCTTGTCGCCAAAGTTGGTCGCGCAG
TCGTCGTTCTGAAACACGCGCTTGTTGTCGAGCCACACCTCGCAGGGGCCCTACCAATGAGTGCAGCTTGAGTATACATAGAGTAGTGTCGTTGGGTACC
GTGTGGCTCGGGATGAAGCCTTCGCCCGTGTCGGGGTTCTGCCACGTCATCTTGCCGTCCGATGGGATCGCCTTCTTGGCGACGTTGGTGAGCG