Description :
From Genome Similarity Track
Location :
Scaffold_1716:210- 1984
Transcript NameFunction/comments
Phyag_g11324hypothetical protein

Sequence
1774 bases(100 bases per row)
CTTGAAGTAAATTATTTCATCATTGGACTTATCGGCACATGCGTGGCCGGAATCTCAATGCCGGCGTCTGCTCTGCTGATTACGGGAATGATCACAGCCA
TGACAGAGCAGTACGGACAGTACCAAAGTTCTGGCGAGACTTCCCACTTAACAACACTGTACAACGACGTGGAGCTCTACGGCATCCTGTATCTTGTTGG
CGCGGTGGTGGTTGCAATCTCCACCTTCCTGCAGGTTTACTGTTTCAAATTCATGGAGGAAAAAATCACCACTCGCCTGCGCAACACCAACTTCGAGGGT
CTCTGCCGGCAGAATgtcggcttcttcgacgagaaggagaacgcCACGGGCGCCTTGACGGCCGATCTGGCGACGAACGCGACGAAGGTGTCGCTGTTGT
CCGGAGAATCGCAGTCCCGTGCTTTCCAAGCTGTCTTCACCTTGGTCGCTGCACTCGTCATCTCGTTCGGGTTTGGAAGTTGGTTGTTGTCGCTCATTAT
GGTGGCCCTCATCCCGTTCCTGCTCTTTGGACACATCGCCCGGATGAAGCAAATGGAGAGCAGCGGCCTGATCTCTGACGACTTGGCTATCCCTGGAGCC
CACGCGTCGGAGGTTCTGAGCAACATTCGCACTGTTGCCGCTCTCGGCATCGAAAAGAAGTCTGTGGACGTGTTTGATGATCTGCTGGCTGAACCACTAC
GCAAGGGCAGCAGGGAAGCGCAGGTCAACGGTCTTTCGCTTggcttcagctccttcatcatgATGGCCACGTACGCGCTGATATTCTGGTTCGGTGCCAA
GAAGGTTAACGATGGCACAGTTGGTTTCACCGAGATGATGCGAACTCTGATGGCTATCACCATGTCGATTCAAATTGTGAGTAGTGCTTCAACGTTTATG
GGAGACGCACCTAAGGCATTCAAGGCCGGATCTACGATTTACGCCATTCGCGACCGCATCACCCCAATCGACTCGTTCAGCCCTGAAGGTCTTCGTCCAG
TCAAGGTGGAAGGCCGTCTCGAGTTCAGAGACATCTCGTTCCGATACCCGACGCGACCGGAGATCAACGTGCTCAAGCACTACAATCTCACCATTGAAGC
CGGCCAAACTGTGGCGTTCTGCGGACCaagtggtggcggcaagaGCACCATCATTTCACTGATCGAGCGCTTCTACGACCCCGTGGTCggcgaggtgctg
ctggatggccaCAACATCAAGGACCTGAACCTCGGTTGGCTGCGCAGTCAGATCGGTTTGGTCGGCCAGGAGCCCACGCTGTTCATCGGCACCATCGCCG
AGAACATCTCGTACGGCCTGGCAGAACAGCCGAGTcagcaggagatcgaggatGCAGCCAAGATGGCCAACGCCCACGACTTCATCACGCAGTTCCCTGA
CGGCTACGACACTCAAGTCGGCATGAAGGGTGAGCAGTTGTCGGGAGGTCAGAAGCAGCGTATCGCCATTGCACGTGCCATTCTCAAGAACCCGGAcatt
ttgttgctggacgaagccACAAGCGCTTTGGATTCGGAGAGTGAGAaagtggtgcaggaggctctggacaaggtggtggcgttgaagcgGCGCACGACCA
TCGTCATTGCCCACCGCTTGTCGACAATCCGTCGCGCTGACAAGATCTGCGTGGTGAGTGGCGGCAAGATCGCAGAGCAGGGCACGCaccaggaactgct
gcagctgaacggCATCTACGCCAACTTAGTGGAGTCTGCGTCAGCGTAGACAGATTGGTTACTTGCAATCAATA