Description :
From Genome Similarity Track
Location :
Scaffold_2526:210- 1379
Transcript NameFunction/comments
Phypl_g15174hypothetical protein PHYSODRAFT_496021

Sequence
1169 bases(100 bases per row)
GTTGCAAGACTGAGTAACCTGTAGGTGAGCAGTAAGACTCTCCTCAATCTGATGCAGCTTGAACGCGCGCACCTCAGTGCCACTGATATTGACGTGTGCT
TGCGCCTGCGCGCATTCTTCTGCGCTCGGGAACATCAACAGCACGTTCCAGTCCTTCAGCTTGCCATGTACTGACGCATCTTGGCTGTCTTTCCGAGCAC
TGCGACAACCTGGCACTGGCGCTACAGAACGCACGGACACCTGCAGCACACGGTCATCCCGTGTGTCCATTGTACAGTACGTGCGGTGAATCGGCGCAAA
CACCTTCACGATGCCTTCTCCTTCCCCGTCATCTGGGCTGCCGTCATCGTTTTGATCGGGGATCTTTTCTACGAGCACGAATGCCTCCGGATTCATCACC
ATCAGTAACCTTGTGGGCATCAGCAAAAACCGCTGTTCGCGGTACATGCATCTCAATGAGACCATGCCATCCAACGGAGCTGTGCACGAACCTctgccac
ctgcagcactCGCTAGCACACTCGTACGCGGATGGCGGTaggcaacaagctgctccaATCCGTCATCCACATAGCTTTCATCCAAGAGTTCGCGCAGCTT
TCGCAGGGAGAGGAATACGCGCATGGACTTACGACATACTTCCATTTCATTAAATGGACGACGCAGTGCCAACGTGTCCCCCACCGAACCAGCCCACGCT
GGAGCATTTTTCGACTCTTCCCTTTCAAGTGGAACGAGACACTCAAAAGGTGACGAAGAATCCAGCTGCAGTTCCATAGGGAAGGGCTTGCGCTGGAAGT
TtgccacctccttctccaacaCGTAAATGAACAAATCCACTTCAGCCATAGCACCGCGCATACTTTCCATGACGAGATGTGCACAGCTCGAGTGGATATT
accaagtgcagcagcgtgaggcCGAGTGAGCCAGTGGGGAGACGGTGTACGTGTGTCGACCATGATGTCCACCAGCAATcgcgcgcagagctgcacGTTC
AGCAGCCGCGAGCTTTGGTTCCGCGCAAGAACCTCCAAAATGAGCTCGACTAGCCAGAAAGGGTATGCGTCTGTACGGCATGAACCGTTGTCTAGTTCCG
CTTCACTTGATACTCCTTCGGTGGCAGTGACATCTTTTTCAGCACCCCCACCACTTTCGTGCGagccag