Description :
From Genome Similarity Track
Location :
Scaffold_642:210- 1318
Transcript NameFunction/comments
Phymu_g11311hypothetical protein PHYSODRAFT_252207

Sequence
1108 bases(100 bases per row)
CCAGGGTATAAGCCCAGGAAACCCGGAGTCGGCTCACCCTGTACCTCGCCGAAGTACAGCGTGAACGTCTGCTTCCactcctccaccttcgcgCGGTTCT
CCATGAACTGCGGGAATCCAGCCATGTTGGCTTCTGGAATATCCCAAGGCTTGTCCGTGTTGATGTCGGTGCGCACACCCGGCGCCACAGTATCGGACTG
CACCTCCTCGGACAAAGCCCAGTTCATAAAGAgcttagcagcagcagggtGCTTGGCCTTGGCGAGAATGGCAGCACGTTGGCCCCAGGAGATGTACTCG
GTGCCGTTGCCAACTGCAACGTTACCACCGATATCGGTGCCCATGCCGATCACAGCCTCTCCATCTGCCACCTTTTCGGCCGCGACGTTCGAGCCACGGT
GGAAGGCGACACTCTGGTTAGCCAACTTGGCCACCCAGTCCCAGCCGTACAGATCCACATAGCGGGTGAACAGGTACAGCacggcatcgtcgtcgttcgG
ATACGAGGAGGCAATTTTACCAGCCCACTGGGGGTCCGTCAGACTCTCCATTGATGCCGGTGCAGTGATACCATCAAGGCTACTGGAGTTGTAGCTGGTG
TAGAATGAGTAGACGGTGTAGGCCAGCCACGCGCCGTCGTTGTCCCTCAGCGACGGGTGAATTTTCGAGAATCCGTTGGGCTTGTACTGGAGCAGTTTGC
CTTCGTCAGCCCAGCGAGTGAagtcctgcagcgtctgcagcgccacgacATCGGGCACTAGCGTGTCGGTCTCCAACTGGTTGTCAATGCGAACGTCGTG
GTATTTGCTGTAGTCGACAATGAGGGTGAAGTTGATTTCTGggaaacgctgctggaaggctTCGTGGAGATAATCCTGCTGCGTCGGGGTGTCACCTCCG
TGGTACAGGACGAGCTTGCCTCCTTcggccacagcttcagcgtaCAGATCATCGATAGACTTGGTCTCCTCCTGCACTTTGGCCAGAGCGCCGAATGAAA
GCAGAGCGAACGTTGCCAGTGgagtgaagagctgcatgGCTGAGGTGGTCTTGAGAAGGAAGAAGGGAATTTGGGAATGACGACTATTTCTCTGTTTTCC
GAGTTGTT