Description :
From Genome Similarity Track
Location :
Scaffold_1139:21- 6040
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1139-snap-gene-0.2Drug/Metabolite Transporter (DMT) Superfamily
Pytve_DAOMBR484maker-pve_contig_1139-snap-gene-0.3Drug/Metabolite Transporter (DMT) Superfamily
Pytve_DAOMBR484maker-pve_contig_1139-snap-gene-0.4Conserved gene of unknown function

Sequence
6019 bases(100 bases per row)
GTAAGATAATATTTTTTGGCGTAAGATAAGATTTTTTTTGGCGTAAGATAAGATTTTTGCGGGAATGATCCAAATCGATCTCTCCGGACCATAACTGGGT
CTTTCAAATCACCCACTTATCGTGCACTACGATGTAGCTAACCCACTTTTGGCATGATACTCTGCATTTTTTTACAATACGATTGCACTCCTAGACTGAA
TATTGGTATACATCAGAGTATGCATTGCTCTGCATTTGTCATACAAAATCGAAGTGAGATATATCACATTTGCAAGGTATGAAGTCGTGGGCACCATACT
CCCGTATCTGCATCTGCAGTTTTTGGCAGCAGACGGTCGCTAAATCGCATATAAAACGCTGTTGTTTAGCAACCCGAAATCGAACGATTCTAACGTTTCT
ACTCTGAGATCGTCCAACCTGCAGGCTTGCACATCATCATCCGCCACCGTCCGATCCGAGGAGCGGGGCTTCGGTGGGGACGCTGACGACGGCGAGGCGG
CCATGGACGTTAAGCGGCTGCTGTGGGAGTCCAAGCTCGCGATCGCACTCGTGCTGCTCATCGCGGCGCGCTGCGTCGACCGCGTGCTCTACACGTGCGT
TGGCTGTCGTTGTGGGGGTTACATGCAAGGTGTCGGCTGGGGTGATGGTGGCTCACTTATTGGTGGTCTGCTGTTCTCTTGGCTCCAGCCGGATCACGTA
CGACTACACGGCCTTCCTCTGGTACTTTACCAACATCATCCTTCCCATCGCCTTCCTCGCGTCCTCGGTTCCCGTCGTCATGTACGTGTATCCAGCGTCG
CCGCCTTGCCTCGAGCTGAATGTAGAGTAACCTGGTGATGTGTGCATGTGTGACAGCTACAAGCACTACTTCACCGGTGAGAGGCGGCTTCTTTCAGTCA
GTTCTGTTAAGATGGGAAGCTAACTTGTAACGATGGTGCTGGCAGATGACATCACGCCCGAGATGCGGCGCTTCCCGCACTACAAGTACATGCTAATGGC
ACTCTTCGACACGCTGTACAACCTCTTGGGTGCCTTCCCGACGCCGCACATCGGGTACGTCGTGTTGTCAATCTGGCGAGTGGTTTTGCAGTCGATCTCA
TCGCTTGTGTGACACCGCAGCGGCAACTTGGCGAACGTGCTCAACCAATTGAGCCTGCCGTTCAACATGCTGCTCTCGTACTCATTCCTGTCGACGCGCT
TCAAGCGCGGCCACCTGCTCGGCTCGACGCTCGTGCTCTACGGCGGCCTCGTCAACATGCTACCCGTGCTCACGGGCCAGGAGAGTGCGAATATGCCCGA
CGCGACGCCCGGTTGGATCGTGCTGTACATTGTCTCGCTCATTCCCGCCGCCATGTCGAACGTGTACAAGGAGATCGGTCTCAAGGACGTGGATCTGGAC
ATTTGGTACGCCAACATGTGGATCAGCTTCTACCAGATCCTGATCGGCATCTCGACTATCTGGACGGTGCGCATCAAGGCGTTCAGCGACCCGCCTGTTC
CCTGGAGCGACCTGCTCTCGTACATGGGGAAAGCCCACAACTGCTTCTTGGGCAGCCCGGTCGAGCTCAACGGCGCACACCTCGAGTGCGACTCTGGCGT
CTTCCAGGTCTTCATGGTCTTCATCGTGTTCAACACCATCTACAACCAGCTGATGCTGTACATCTTCAAGGAGGGCAGCAGCGTGCTCTTCGTCGTCTCG
TCGGCGGTTGGACTTCCCCTCACGGACGTCCTGTACCTGTTCCCGATGCTCACTGGCCCTGCCGCGGGTCAGACGTTCACCATCTACGACGGCTTTGCGC
TCTTCGTGCTCGTCATCGGTCTGCTGGTGTACCACTCGGAGAAGGAGGAGCGCAAGAGCGGCACCAAGTCGTTCGAGAAGTCGCCCATGTACGCGTCGCC
TACGCTGCAGAAGACGCATCTGATGAAGAAGCGGCGAGGCAAGCTGCTGTACCACCAGAGTCCGCTGCTTACGCGCAGCGGCAGTGGCAACAACATCTCG
CAGAAGCTGCTGGGACGCAGCACTGGTGGCCGCGGCAAGTACGGCTCGACGGATCAGTCGTGATCGCCGAACGCCACATACAGATGGACCTCCAGCGAGG
TTGCTCATAGAAGTTGTGCACGGTAGAGCAGGAGCTGCGGCTCTTTCTCCGTTGTTTTGTGTCGCCTCGTGCGGACACTGACAATCGATACTGCTTTGTC
CATAGACTTGAGGCTCATATGTTGATGTTGCGAGTTTCTACTCACGCTGACTCACTGCTGTGCGAGACCTGGAGCTGAGATCACACCGAGCGATGGGATG
TACCTGTCGCCTCGCCTCGCACGCCGCGCCTTCACGCTGACGCAGTGACCGAACCGTTCCGTCTCCTGTGAGAACGAGTGGCATTCCAAGTCGGCCAGTC
CATTTGGAATCGAATTGCGCGGGAGGCGAGCAGGCAGCGTGTCGGCCGAGGTCGAGCCGAACAACGGGTCTAGCATCAGGCTGCTTGTGGCATCGCTCAC
TTTCTTCTGACGCCGCGGCACAGCAAACACGTATCGCGGAGATTCTGCCTGCTGGCGCTCCTCCTGACGCCGTTGCGGCGAGTCGCTCTTCCCAGGTGGT
CGCGTCATGGCGAGGTCAACACCGTTGAGTCGAACTGGATTTGGAGATCCTGGGCTGACCACGACGATGGGAGATGTCGGTCCGTTCTCAGATAGCGACG
CTGACAGGTTTGCGATCGGAAGATCACAACCGGTCTGACGAGCGATGGCTGAAGGCGGCAGCGGTTTGTTGTTGTCAGCGCTCGACTTTCTCGATGGTGA
AGGCGAGAGCAACGGAAACGCCGCTGCCTGCTGGCGACCTGGGGGCTTCGACGGAGAAGCACCAGAACTTCGATGTTTACTGGTTGGAGGCATGGCAACT
GTCCCCACTACCACCTGAGAAGCCTTGCGATCGTGTTCACGACGCTGCTGGTTCTCGTTCACGGCAGCCAGCGTTTCTCTTGCCAAGTCGCCGACCGTCT
TATCCTCGGGTGATGCGAGCGCGTGTCGGCCTTGGAGCTCCTTTGCAAAGTCATAGCCGAGTCTCTGCACCTTATCCATCAGCGACGTGGGTGTCGGATC
GCCGTCACGCTCAACCCGCGACGGAGATTGGTGTGTGCTTGATATGCCAGTCAAATACGCGTGGTATTCGCCGAAAGGGTAGGCAGCAACCGAGTGAACC
ACTCGCATGGCGTGGAACTGGATCGCTTCCAGTCGGAGCGTCTTCGGGTTGAAGTCGTTGGCACTGATACGGTCCAGGAACGGAAGGAGCAACTTGGGCA
CTCCCAGTTCAACCACTCTGGGGACGCACACAAGAATGTCTTGGCTCAGGGTCGCGATGGCACCTAACACGTGCTCCAAGACACGAAGCTTCTTCTTCGA
GCTCACTTTGTCTGCATTGGATAGCAGCGCCACTCCGCCTTCGTAACGGTTTTTCAGTAGCGCAAGCAGCAAGTCGAGAACGCGGAAGTGGAGAAACAGC
TCGCTCGTGTTGCCCTCGACAGTGTTTGTCATGGCGAGCCTCGAGATCACCACAGCGATCTCGCTCTTGCAGGCGACGTCTTGCTCGATATTGGCTGCAT
CGCAGAGTTGCAGGCGCTTGAGAATCCGAGGAAGCACTTGTGCGCGCATGATCGCAGCTCGACCCTCTGACACCGCGCACAGCTTCCCCAACAGCGTGTA
CAGCGATGCTGACACATCCAGCAAGCCATGATCGTCGGTCTCTGCGTCCACAACCAGCGTCTTCGTCTTGGCTTCATCGCGTCCATCAAGCAGAAACTCT
GGGAAGTGCAGCAGCCCTGTCTGGAGACTACCCTGGGACAACAGTCTGCAGGTGGCCTCTGTGGTGCTCGCAAGTCGGCTCAGCGAAGCGCAACACATCT
CGACGAGCTTCGGATGCAGATTCTTATCGCGCAGCAGCTGCAGAATGGCCGGTGCGGCGACCTCAACGAGCAACAGGAGCTTCTCTCGAGCATACTTGCC
GTGTTCGTGTGTCGCAAACAGCCTCAGGAACTTCTGTCGAGCCGCCTCGCCGTACGGAAGTGGTCGCAAGTACCCTGCCAACTCGACAGCAGCCGAAATC
AGCCCGATCTCCACATCTAGATCGTCAGCGGCGGTGTTGAGCGGCCGAATATATGCCACGAGGTCTTGGAGCACGTGGAGTCGAACCACTACATCACAGA
TCATCCCTTGAGGCAACTCGGGAACTTGCGCTGAAGTCAGCGAAGGGCGGAGACGAGCCTCGATGACATCGCCATCACCGCTGGATGAGCAGCGCGCGAG
TCGGCTAAGCGCTTTGCAAGCCTCTTTCGATCCGAGTCTGTGGAGTAATCGCTTGTCAGGCAAGTACCGACTGACCTTGTGCTCTATCTCGTCCAGACGG
TTGCATTGGATGCTCAGCGCCAAATGGTTGACAACGTCTTCGGAGAAGCACGTCTTGGCGATCTGTTGCGCGCGGAAGAACCTGCACAGCACGATGCAGC
TGATGTTACGATGAATCGGGGTCTGGAGGGCTGGTTCGAGACAGGACGGCGTGACTGGCGTGATAAACCTGACCAAGGTTGCCAACGCATCAGCAGAGTA
CAAGAACATGGCGGCTTTCTCCGCCGAATGGGACTCGACGCCTTGGTCTTGGATCACCAGATCCAACAGCAGCGTGTATAGTGCATCGAGCCGACCTTCA
AACGTTTCCACTGCGGCGAGCAGCCACGACTGGGACACTTTCTTGCTCGCTGGCGTCTGCCTCGCAAGCAGCGCACAACCGATGAGACCCATGACGAAGA
CGTCCGGAGTCTTTGTATTCTCGATGCCCATCCGACACCAGACCATGAACAATCGAATCGCTCCTGCAGTCGTTAGCCCGCTACGACCATCTGGGTGATC
CGTCAGCTCGCAGAAGAGAGCCAACGCGGCACCGCTGACGAGAAGGCGAGAGTCTTGGAGGCACTGAACAATCTTGTCGAGGTGTCGTCCTCCACTGCGG
GTGAGCACGTCAAGGACGCAAGGAAAACCAAAGGAGCACACCATCGACTGCATGATCGAGAACGCCGTCACACAGCGCTTGTCGTTCCGAAAACCGCTCT
CCTCCAAGATGCGGAACAGCCCTTCGATGATCTCGGGCTGGATCAAGAACGAGACTGCAGCTTGCTTGAGCCTCTCCAGCATGAATGCTTGCTCCGCATG
GACCGCGTTCGCAGCCGAGACAAGATGTGTTGTTGCTGGAGTCTGTCGCTGGAATTGTTCGTGTCCGCGCTGCATTTGGTCGCAGAGTACATGCAAAAGC
TCAAGCGCGGCATCCAGCATCGAACTGCCTGTTGCTTCGCCATCTCCACGACTGTCACCGCTCGCGCGGAGAACCGAACGCGCCATCTCGGCATGCAGTC
GCTCGACAATGTTGTTTTGCAGCACTTCGGCGATTTGCTCGGGTCCCTGTCCGATTGCAACCTCGCGCACAATCGAGATGATCATGGCCGTCACAGCTGG
CTGTTGGTGCTCAGTGATGAGAGAAGCGAGAAACGCGAGCGCTCCAGAGCTGAGCACCTTTTTCTGGTTGGCAAGCACAAACCCCGGAGCGGTTGTTGCC
TTCGTGTCCTGGTCGCCCAAGTCGTGCTGTCGAGTCTGCACCAGACAGTAGATAATGCGCACGTACGCCTGGACGGCGTGGTCGGGCAGACCATGGACAC
CAACGGTGTCGCGGAACACTTTGAGCTGATGCCGCAGTTCGACGAACTTGATCAGGTGCATGGAGCGAAGGCGAGCGCGCACGCCCACGTCGTACTCTCG
CCTGTGCAGGTTGCGCTCGAAGAGCACTCCGCGCCAGTGGTGCTGAACGATGCGCGCGCACAGCTCCGTCTCGCGCAGCAAGCATCCCACGCTCTTGCCG
ACCTGGAATCGCCAATAGCGAGGAATGCATCAGCTATCGCGATTCAGGCGGGATGGCTGCACAGACTCACCGCGTTTTCAGTCGATAGCACGCGTGCGAA
CCATTGTGCGAGCCGTCCG