Description :
From Genome Similarity Track
Location :
Scaffold_1513:21- 4418
Sequence
4397 bases(100 bases per row)
CAAGTCTTTAACCCTGGGACAGACTTACAGGGCGCGCGCCGGGATGACAGTTTGGTTCTGGCGGATTGGGACCCTTTCTTTTCCCTGCGGGGAGTCGGAT
CTGCTCAGCGGGCGGCCGCCGTTTTATAGGAACCGATATTTATGAATCTTAGGCGCGATTAAGACCCCTTGATCGGACCCCGGGGAACCTTGGAACTCCA
AGCCCGGTTAAGGTGGCCGGACCATGAAGGACTGTGGGTCACCCGGGCCGAGAAATGGGTACTTACCTTAATCCAAGGACAAGGTCGATGGCAATACCTC
CAGGTAACGAACGTCAGCGACAAGAGATTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTGGCGAAGGACGGTATCCCTAGGCGACCTGGATATG
TGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTTCGAGGCGACTACCGAGATCGAATCTTTCGCAGAGGTGGAGCTCCCAGCGGAGCC
AACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGGAAGTTGGATCCAGG
ACGGGGGACGATCCCCAGAATCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAGCAGTCGGATCTTGCTGATCCAC
AAGTGGATCCAAGCTCTCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCCGAACTGTCGGGCTTAAACTCGTTAGAGGA
CCAACTGGATCCAACTGGTGGTTTCCCTGATACCAGGGTACCTGAACCCCCGAAGATAGAAGGACTGCCAGGCGAGAGAGGGCCGCGGTGTTTGGATCCA
ATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTCTGTTACCGTTAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATCCCGGA
GGTACCACTGACCACAGAAGAAGTCACGATTGATGATATCCAAGTGGATCCGGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGG
GAGAGCCGACATCTGCTGATTGGTTACGGAAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTC
AAAGGGTGCGGAAGGTGGCACCTCAGTTCCGGGAAAAACTATCGGACCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCGACGTCCCCGTG
GGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGGCTGGTTAACGGTCTGACTCGATTGATGGTGTA
TCCGATGCCTCTTATCAATGAGCTATTGGAAGATTTGGATAAAGTACTCTGGTACTGTTCTCTAGACATGGCCAGTGGTTTCTGGGTGGTTACTATGACG
GATCGAGCTCGCGCAATATCCGCATTCATCACACGTTTGGCCGTTCACTGGAACGAAAGCCCTTGGAAATGAAAGACACCCCCCCCCCAGATTCTACCCA
AACGCCCTGATTCGATAAACGCCCTCTATGGATTCACCCGAAATACCGGAGTCCGAAACAGGTGGTTCTGGGGAAGGCCATACGGAAGTGGATCCATTCG
AAGCGGGGGAGCCAGGGGATCCTGGGACCCCATCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTGATCCCGGCGGAATCGTGGGATCAGTTGTG
CGAGAGAGTGACGTCCTTACTGGAGACGTGTACTAAGTGGAATCTCTCTATTAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGAGTACTTGGGC
ATCGAGTTTCCAAGGAGTGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGCCGATTTTGTCCTTCCCACAGTCTTTACGGGCGATGGCATTCTTTT
CTGGGGCCATTTGGAACTACTACAGTCGGTTTCATCGAGAATTTACGCCCTGTTTTCCCGGCGTATTTTTTACGATTTGAGAGGAGGCAGTTTTTGCGCG
AGATGAACACTCCCAGCGTTCCGAGGGAAAATTCCCACAAATCTTGGGCCCCGGGAGATGCCGGGTTCCCCGAGAGAGATTCCAAGTGGTAGGACGCCAG
AGAGAGGACGACAAACAAGCAGGAGCTGGATCCACGCCGGGACCCACAGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCA
GAATCTCGGTGGTTCCGAGCTCAACACGCATTCGTGGAGCTGAGGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCGAAACGTCAACCTA
CGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCATCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAA
GCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACGTGCGCTCCTGCGCGTATTGGATCTAAATTATAACCTGCTAGTGGGAAGATCCATCCGG
ATCCTGATTCGACACTCCACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTGCAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCACCTTGGACGCTGG
AGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAAGATCGC
CCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATACCGACGGTACAGGTGGATGAGGATCTATACGTCCTGAGTTTCGATGGATCCGCTCGTGTA
CGACGCGAAGGGGGAGCATACAGTGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGGGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATG
AGGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGGGACAAGATCCGAAAGGTTGGTGATTTGTGGAGATTCAAATTTGGTAATCAGACAG
TGCGAGGCGAGATTGACTGCAGGCCCCGGCCTAACACTGTTACGGCAGAAGTGATGATCCACTGGCTGGTTGAATGATTCAGGATTGGTGACATTTCAAG
CGAGTTTGGAATGGCCCGGTGCCATTGAGTCTGGCCACATGCCCCCTTTGGCGAATACAATGTGGGTTTCCTAGTGGGAGAGAGAGAACGCGGCTTTCAG
AATTTCTCTTATTCTCTTAAAACCCCATCTAGGAGAGAGTGGGTGGTAGTTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAG
GAAGGGTTGGATCCAGCCCCCAGATCCTCGAGGAAACATTGGTGAAGGGAGTCCGCATTAAGCGGATCCTCAAAGCACATAACGAGGAAGCGTGGATCTT
GGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATACCAAATCCTACAGTATTATCGCTACGGATTACGCAGTGGATCTGAAT
GACTTGCTCTTCTATTGCCCCCCCCCCCCCCCTACGAAGAGAGACAACGAGGATCGGGATGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGG
ATGTCCTACATCACTATCACGCTAGTTTAGAAGGTGGACATCAGGGAACTGGTCGGACCTACCAACGGATCCGGGAATGTTTCCACTGGAGGGGACTATT
CAAGAGTGTACAACGATATGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACCATTGAAGGGGAGTCACCTGGGAATGCCCAAGCGACT
TACCCTTTCCAAATCATAGCCATGGATCACATCCCCTCGTTACCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATCTGGGTGGATCTGTTCACCGGAT
ACGTGATAGCCAAAGCTAGTGCGTCTAGAACTGCACAAACCATTGCCGAATCGTACGAGGAGTGGTTTTTTTGAAGATTCGGAGCTAGGGAGATGATTCG
GCATGATCGGGAGCCAGGCTTTATGTTTGATTTCTTTCGATCCTTCAACCGGACCCTGGGGCCGAGACAACGGGCGACTATGGCATATCGCCCCCAAGCC
AATGGATCGGCCGAGCGCATGGTACAAACGATCACGAAGGCGCTCAAGATGTATGTTCAAGACTTGGATCAGAGGGATTGGGATGGGTACGCAGAACGGC
TCACCTTCGCAATGAACCCCGCCCAGGACAGGATCCGGGGCGAGACTCCATTTTACTTGGTACATGGGTGGGATCCTAAATCCACCCTAGAAGCAGC