Description :
From Genome Similarity Track
Location :
Scaffold_525:21- 4119
Transcript NameFunction/comments
Hyaar_Emoy2814280hypothetical protein
Hyaar_Emoy2814281hypothetical protein

Sequence
4098 bases(100 bases per row)
TATCTGATTGTCTTGGTAGATCAAGGCTAGTAAAGTTACTCTAGGCTTGTTGCAAGCTCACCAACGACTCTACCACTTGCTCAATCCAGCATTCGATTGC
TGCTGCAAACCCTTCCTTATTCAAGGCCAGTCCGAGAGCCTAATGTCTTGCTGCAACTAACGCCGGACGGAAGGTCCCGTGGTCTTTTGGCGTTTCGAAG
GTCCCGTGGTATTTCGGCCTTCCGAAGTTCTTTTTTTTGGCGCTGGTGCAGGCTCGTGTCTCAATGCAGCGTATTTCTTCCTCATTGAACTGGACGCGCC
CTGGTCGCTGCGTAAATTTGTCGTCTCTGCGGCCTGTTTGATGGTTTTCTCCCAGCCCTCAGTCAGCGCTACCTGGAACGCTTTCACCGCCACATCCTTA
TTAGTATTGAATAGTTCTGTTCCTTCTTCTCGTTGATAGTTGCGCATTGCAAACAGCAGACGCTGAGCCGTGGGTTCACTGATATGTGCACCGTGCATGT
GTGCAAACATTACCTTGGGGGTTGTACCCGTTTGAATCCACCGCTCAACGAGATACCATAGCATCCCGTACGCAGTGGCAGACTCCTCCCCCAATTCTAC
TATTATCTGTTTGTATCTCTTGAGGTAGAGCACCCTATTGAGGGAGCAATATATATCACTTCTGCCGCCATTAGGACCGCCGATCTCTATGAATAGACGA
AGTACTTCCAGCATTTCGTTCAGCAGGCGTTGTCCTCGCGGCTCCTCGTTGAAAAGCCCCAGAAGGCCACAAGCCTTTTCGAAGGAGATGGATTTATCCT
TCCCCCCTTTCCAGACTTGTAACATCGCCTTCTCCAAAGCAGTGGCTTTAGTGCTGTCAATAATACCATTCACCTTAGCTTCCAGCAATTCAGACGCGAG
ACTGGCGAGGCCATTATCATTGGAACCATACTTCTCCACCAGTGTAAGCATCAGCTCATGTGCTTCCAGAGGATCATGCTCCGTCCAGCTTTTCCACTCA
TCAGCGGTAAACAGCTTCGGAACCGTTTGCGCTTGCGCATGCTCGGTGATCCTTGTACTGTCTGCTTCCGATAGAGGAGCCATGACAGGCGCATGATCGG
TGATCCTCGTACTGTCTGCTTCCGATAGAGGAGCCACGACAGGCGCATCCTCTTTTCCCAAGCGCAAAGTCAGATCGAGCTCTTGTCTTGAATGCTCTTG
CGAATGCGTTTTCGCCACGGTTCCGCTCGACTCAAGACGCTCTTTTCTCACGCGCGAAATCAGATTGAGCTCTTGCGGTTGGGTAACTGGGGTTATCATG
CAGCCCATTGAGTTGAGTCCGAGCTGCAGCACTAAGCGTGCTGGCAGCAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTGCGTATGGGACC
TCTTCGCCGGCATAAACCCGATGTACCCACACAATTGTCATGAATGACTACAGTAGCCATGCCTGTCCAACGATGACGATGTGCTGAAGTGAACCAACAA
GCGATTTGCATGACAGACCAAGGGTAGACGACAACTGATGCACGAGCAATTTCCAGAAATTGCCAAAGCTGTAGAAATAAGAGTCATTTTTCACTTGTGA
ACCATCCTTCGTCTTCGCTCGATCGATGTGCCTGCGTTGCGCAAGAATAGCACGTAGTAGTGCATCATCAGTAGTCTGTCTTTTCAGCAAATCCGTCG