Description :
From Genome Similarity Track
Location :
Scaffold_2325:21- 2943
Sequence
2922 bases(100 bases per row)
GGAGAGGAGAGATCCCAGTCCTGTGATAGGAGCCGACGGGATTCTTGACCATGGAAAAAGGCCAGAATTTTCGGTGGATCCGGAGCTCAACACGCATTCA
TGGGAACTGAGGACCAGGATCGCGAACCACGCCTATCCTTCCATCATTTCGATCCGAAACGTCAGCCACGGTAATAGTTTATGCCAGTGACTGGGCAGTC
TCAGCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGGGCGGTGGAGA
AAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACTCTACGCTAGCCTGGCT
GTTCAAGTCGGCCGGGTTACAAGGACAGTGGGCAGCTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGA
GTCTTGGCCGCGAGCATTACTCCTCGAGCTAAGCTGGATGAGGCGCTGACTAGAATCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCC
CGACGGTACAGGTGGATGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGTGTACGACGCGGAGGAGGAGCATACAGTGCAATACTGTGGAAACT
ACCTGGATGAGAAGTTGTACGGGCCGGATCCACTTACGCGGAAGGCCTCACCGTCAATGATGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTTACTA
AAGGGACAAGATCCAAAACGGCTGGTGATTTGTGGGGATTCAAATTTGGTAATCACACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACAC
TGTTACGGCAGAAAGTGATGATCCACCTGCGCGGTTGGATGAATCACGAGTTGGTGGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCA
GCGCCGCTTTACGGAATCATGTGTGTTGAAGTGGAGAGAAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTGGGG
TCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTCGAGGAAACATTTGTGAAGAGAGTCC
GCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACTTACGTCGGGAGGATGT
CAAATCCTACAGCGTTATCGCTACGGATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCCCCCTACGAAGAGAGCCCACGAGGATCGGGA
TGGATTGATGAGATTGGTGATGCCAGAAGCCTTGCAACAGGATGTCCTACACCACTACCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGGACC
TACCGACGGATCCGAGAATGTTTCCACTGGAGAGGACTATTCAAGAGCGTACAACGATATGTCGGTAAATGCGTGGATTGTGAGACAGGCAAGGGCAGGC
CCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCGATTTACCCTTTCCAAATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGG
AAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGATACGTGGTAGCCAAAGCTAGTGCGTCTAGAACTGCGCAAACCATTGCGGAATCGTACGAG
GAGTGTGTTTTCCGAAGATTTGGTGCTAGCGAAATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCTTTCAACCGGATCGTGG
GGCAGAGACAGCGAGCAACCATGGCATACCGTCCCCAAGCTAACAGGTCGGCTGAACGCATGGTTTCCAACGATTCACGAGAGCACTCCAGAATGTATGT
TCAGGATTTGGAATCAGAGGGATTGTGGAATGTAGTACGCAGAAAGCCTCTCCCTTCGCGATGTAACACCGCCCAAGAACAGGATTCGGGGTGATACCCT
TTTTTACTGGTACATGGGTGGGATCCCAAATCCACCCTGGAAGCGGCCATTTCGGTATGTAGCACCAAGAAGAGAAACCGAGATCCAAGACGATGGCGAT
ACCAAGTCCAGAAATACTACCGGCAAGCCAGATCCCAAGTGAACGAACGGCGGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGACGCCCG
TCCGCATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCCGCAAATTGGCCCATCTATGGCATGGACCGTT
TCCGGGTGAGCGAGAAGTTTGGAGAACATGCGGTAAAAGCTGGAAAACGGCCGGGTACCGAATATCGCTTGTTCCCCGTAGTACACGTATCCATGCTGAA
GTTGGTCAAAAAACATCCAGATCGGCCGCAAACCCGTCTTTCAGTGGATGTATCCGACCGCGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGG
AATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAGGATCACCGATATGAGGTCGGGGAAGCGAACTAGATACGGACGGATTTACCGTGAATTTCTGG
TGTATTGGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACTCTATGATTTCTTGAGGGATCGTACGAATCGTAA
CAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAGGGGACCCATGGATGTGAGTTGGTCATGTCGATGGGAGGATGAAGAAGGGCCCACAGGAA
GGGTGTGGGCCAGGAGGAGGAG