Description :
From Genome Similarity Track
Location :
Scaffold_1255:21- 2743
Sequence
2722 bases(100 bases per row)
CAGCACTGCCGGACGACCTCGTTCCGCCCTTAAACAAGCGTCCGTGCGTCACTGCTCCTCCGAGTTCANNNNNNNNNNNNNNNCTTCAACCAATGTCGCA
CATCATACCGATCGAGCTATTAGGCGGCGGTCATTTTCTGATCACTACGCCCCCGAGTGTCGNNNNNGATACTCCGACACCACGACCCGGAGGTCGTCCA
AGTCTAAGATTGTTAACATTCCTCCGTCGGTTATGCCCAGGCAGTCGCAGAAGCAGAAGCGGGTGATTTCTGGATCTGATTCTTCTGCACTGGNNNNNNN
NNNTTTGTCTGGGTCTGTCGATATGGCCACGCTGGCCGCGATGTACTCGTCACGCTATTCTATTCGTTGGCGGTCGTCTGCCTCGACTGCGCNNNNNNNN
NNTGGCTTGGCTCTCACTCCCGTCGAGATCGACTCTACAAGCCTCACACCCGCGATTCGTTCTACATCTGCGGTACCTGGTACCTGCACTTCGTCTACTA
CCCCCGACTAGATGCATGTCACTGGAATACCCCAGGAAGAAGAGTCACACGAGGCTTCCAATGACTCCAATGGATCTTTCAGTGTATCAAGCGGCGGTCA
TACCACGGTGAATCAGCGCCTCTCGCCAATTTCTTGCAAGGCCCTACCCCTCGTGCGGTCTTCGCAGGATAAGTGGATACCTGGTTATAGTGCTCGTGTC
TTATGCCCCTGGAAAATTTGCGCCGTGGTCCTCTCGCCGCTTGGGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTGTTCGAC
CACGTTTCCCGGCTCAAGAACTACCTTTTCTGTTCCGGAACCTCGCGCTTGCCCGCCTTTCGAGTCCCAAAGGTCACCACGACTGGTGACCTCNNNNNNN
NNNTCGTCACGTTATACGGTCAGAGACCATTGAAAAATTCTGGATCGACCGATCGCACCTGTTTCCTTCCCCCGACTGGCTGGTTCAAGTCTTGTTAAAT
GTCTACCGTGATTTTGAAGATCATCATCGCCAGTCGNNNNNNNNNNNNNNNNNNNNAATCATCGTCCAAGCTGCGCGAAGGATTCTGGGTTGAGCGTCTA
CTATGAAGAAAGACGCAGTAGACGTTCATGATCTAGTCCCCGGTGGAAGGCAGTGCTTCGGATTGCGCTGCAGGAGTTGGTCGAGGGACATTTTGACCTC
GACATCCTGCTAGACCCCTTCTTCCTGNNNNNNNNNNTCCCGGACGCTAGAAAAAATGCCTGGGGCATCCGGATTCCGGCTGTCAACAAACCGACATCCT
CAATTTGGCTTCCTCCCTGCGATTGACGGACTCCGCTGATCCCTGGCGTATTTAAATCGTAAGGCAATCGCCGATCACCCGAAATCTTCCATCGACTGAC
TCAAGAACAAGTTCTTGGAGATGTGATTTGTCGTTTCTTGTAGAAAGGACCACGGTGTTTATGACCGCAGTCGTGACCTCCAGTCGTAACTACTAAATTC
GCCTTCATTGTACTTCATTAACTTTTCACATTCCATAATCATTACGCTCGTTAACTGTGTAATTCCTCCTGATGGCCAGCTCGCGTGGTCATTGTTCTTT
CCGCTCACGAACCAGACGATCACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTTGCATC
ACTTCCAATCGATTCCGATTAGCGCCATCACGTTCAAATTTTTGTAACAATGCACTACAATTGAGGTTCTCTTCATCCACACATGTTTCATCACTATGAC
CCTTCCACCGGACTAGAAANNNNNNNNNNGTCCCGATTGTACAAATCTAATACTGTCCACCTCGTATTGACCTTCAGCCAAATTGTCTCCCCAATTGTCC
TCCGGCAGTAGGGCTTTATCGAAATCCACTCTTTTGGTTTCTTCCACCTCCANNNNNNNNNNNNNNNNNNCCGTGCAACAGGTCTATCAAGAATTTTTTT
TACCAATTTCAGCTTAGATATGTGCACGAGTGGAATAGTTGGTATGGGGTTTCTTACACTTCCAGCCATACTTCTTGTTCCTCGCACTTCTCGATCACCC
GAAATGGGCCATGCCNNNNNNNNNNNNNCTGGTATATTCTTCTTCACTCAATTCAAATACAGCCGCACTTAGCTACCACAGCTTATTCCATGTGGACCTT
GACCATAGGTGTGTTGATCAGCCCTGTCCTGAATAGCCTCTATCAGCGGGTCATTCACGGTGACCCGGGCGCGTTGGTACGGTCGCTATATATGGTAACG
CCATCTTCGCAAACAATCTACTGATGAGATGATCTGTAAACTGGAACCAGGATTAAGGGATGTCCGAGGGAAGCTTTTACGTTTAAATAAAAGACGGACG
CTAAAATTACAAGGTCAGAGTTGAGCATCACAATATTTAAGCATCGACGAACATGGCCGGGCACCCAGGCTCTCGTATAATGACAGATTATGGGGTCACG
ATCACGTGTTTTAGTGCATTCCAACGGAAGGGTTGCTTCCAATGTCGACGCGGGTCCCATACATGGATGAGATAGACTGGAGTATCACCTCGGACTCGAT
CATGCGTCGTATTAATGGCGAAGGTCAATCGCTCGTCATAATCATCCCAGTCTTGTTGGTTCACATCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNN