Description :
From Genome Similarity Track
Location :
Scaffold_3229:21- 2353
Sequence
2332 bases(100 bases per row)
ATCCATGCTGGAAGCGCGGGCGAGGATCCGGGGACAGGAAGGCCTTCTGAACGCGAAGACTCGGGATCCAGTACGCCCTACCCGTGATCTGATACAATCC
AGCCAGGATCGAGCCAGATCCGGAAAGAAGCCAGTGGGGTTATCGTCAGATCGGGCTCAAGGTAATTGCCGCACGGATCCGGTCTCGCCAGTGGACCAGA
CGGCCACAGGCTCTTCCGACACTTCCCCGGGCACCCTGCAACGACACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAAGGCATGAGAGCGCCCAA
GCCGCAAGCGCAGGTGTTCCATGAACATGGAGCACGAGACGCCGAGATGGAGTCAGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGATCTG
GATGGCCCACCCCCCTCGCCAGCGGCGGTAGCAACAGCCGCAGCCGGGGACGGATGGATCGTCTATGATCCAGAGGGTACGGATCTCAGCCATATCGGAT
CTGAAGGAGTTCACGGGGTCAAGACGAAGACCGAGCGCGAACATGGATCAGCAAAGTCAAGTCGGCCCCTCATGAGAGATCAAGCGTCGAATGCTGAGAA
GTGTTTGACCTTTGCGGATCTGTTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCAACAGGAACAAGTGGCCAGATTTGCTGCGCAGT
TTTCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCATGGTCGCCGCAGATCAGATAAATCACCGCTAGAATACCTACATCGAC
TAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGAGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGTTGGGAGACGT
GGATCTGGCCGACAGGCTGACCCTGTTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCGGTGGTTTGCGCGAAACACCGCCAGAAGAAG
GCGGCGGTCGGATCCGGAAGATTACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAGCGGCGAAGACCGGAGACAACTCTCGACCGGGGCCGGGGACC
GTGGGATGTACAGATCCCGAGATCTCATGGACGGGACAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATTTGGATGCTGGAAACA
TCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCTAGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCG
ATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTC
GCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCCTTTTTTTGCCTTTGTAAAAAACAACATCTCTAGATTCAGGTAGCAGGA
CCTCAAATCTCGTTGCAAAAATAACCGCGAATCTAATGAAAGGGGTGGGTTGTTCCCAAATTTCTCTATTTGTGGGCCCCGCGGGGAAGAAGATATTGGT
CCCAAAACCACATATTCTCTTCCCACCTCGCGAATTTTATAAAGAGGGGGAAGAGACCGCGGCTTTTTGTGGTTAGAAAAGACCCCACAGGTTGCCAGTT
TGGGAACCCACACGGTCGGTCCTGCCGATCACCAAGTCGTCGGTCATGGATTCTGTGGATTGAGATGTTGGATCATAGATCTGCTAACAGGGGAGTCCCG
TGGATACTGGAGTACATGCCCCAGGAAAGTGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGAAATCCTACTTCTAGATAGTGGTGCC
CGAGGTGTCTATACTGGATACCGCCCTTGCTCGTAAGGTTGGGTGCCAAGTGGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTTGGTGAAGGCGTAT
ACCGTACAAAACGGGAGAACGCGAATTAAAGATCACGCTGGCAGGTTGTTTTGGTGTATTGGTTTGACATTTGGGTCGGGGATCTCGCTGTCAAGACGCC
ATCTTGGGATGGATTTCATGGTGCCAGCGGAGTGAGGTTTGATTCTGGCGATTGGGGACACTTGTTTTCCCCGGAGCGAGAATGGCGCTCTCCAGATCTC
AGCGGGAGCGGCGGCCCTTTATATGGGAGGGCAAGGATGAGGATTCTTAAGGGCGAGTAAGAACCACCCGAGTTGTTTGAAGCCCGGGGAAAACCTTGGA
AGCTGTCAGACCGGTTGAAGTGGGTGGAACAT