Description :
From Genome Similarity Track
Location :
Scaffold_1631:21- 1897
Transcript NameFunction/comments
Hyaar_Emoy2814780Mitochondrial Carrier (MC) Family

Sequence
1876 bases(100 bases per row)
CCCTTGCGCTTTACTCATTTTTGTCAGTGCGTGCGCAATCTCCGTCATTCTTCAGACGAGATTTCGGTGCCTTGTGCACGACGCGCCATCACCTGCGGCG
TTTCCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGAGCGAGGTCATCGTATCAAAACC
TGTAGAAAAGTAACAAAACATAATAAAAGACTTCTGTATTAAAATGTAGGCCAGACGCGTTTCGCCCCCCCGCTAGGGGCTCGTTAGTGGCTTTATTAAA
TGGGAACTAAGCTCTGCTCTATACTGCGATAAATCCTATAAAGAACCTACAAGAACTTATTATAACCAAACACATACTACACAATAACTACCACAACTGG
CATCTAGGGCGTTTACCGGGAACAAGTGGACGTTCGGTGGCTCAAAGAAGCCTCTACTAACCATGCGATGGGAAGGCTACTACACACTTTAAAGACTACC
ATTACGGCTTTGCAGAGCATGAAACTGTTCACCGCTAAGAAGGATTCAAAAAGATCATGGCCCGAGGACTACCTGTACATGTTAGCTGTCAACGCGTGTG
GCGGAGGCGCAGAAGCTTAAGTACTTGACGATATCGTGCACTACGCGTATGCTGATTTAAGGACTGTGTTGATGACCAAGTACAACAATTGGCGAAACGA
TCATCTGCGCCAAGTTGAAGAGCTTGTCCACTTTGCACATTATTTCGAGCTCGAGACAAAGCCCGGCAAGACTTTGGAATGAGAGATCGAAGCAGTCATC
ACTGAAGAAACACGGCGTAAAGATATACTCTCCTGCTAAAATTGTGGAAAGAGGGGGAATTTTAAGATCGAATGCAGGTCATGAGGCAGGTTCAGCAAGG
TGTCCAAGAACGTCGCGAGGTGGTGCTTGCTGTAAGCGACAGCGGACAATACCAGAATGATGACTGGATAATCGCCAGCGGTTCTGGTATACACCTCGTA
AACGACAAGTAATTGTTAATTAAAGCAGAAGATTGCAATAAAGAAGTTTCGCTTGCTGACAACTAGAAGTTCGTTTGTGCAAGGCTGGAAGTGCTCGACA
GTTGTGGTCGCAAATGGACAAGACAAACGGTTAAGCTGAAGAACGTCTACTATGCGCCGAGTATAGCACGCAACATTATCAGATATGGAAAGCTAGATGA
AACGGTCTACAGCCTCAAGTACTCACACGGGATGTGAGTGGTAGCCAAACGCAGTGATATTCAAATCTTGTTTGATAAAACGATGAAGCATAGTGTTTTT
ATCATTGAGACAACAATTTAGTCCACACAAGAAAGTCACAGTAAATGAAATCGTGGCTGCCGTTTAGGAGGAGACAAATGCTCAATATCGTCTAGAGATG
CACCGGAGATTTCTGCTACACTTTCACCAGCGTTTGGGACATTTGTCGTAAGATACGATCAAACATTGCTATAAGCTCAAGCTCTGGCATCGAGATGACG
TATCACAAGCGAGTGACGTTTGTCACTTTCGCACAGTCTTTAACAGACAAAGAACAAGCAGAACCAGAGGTACTCTGGAAAGAATGTACCGATTGATCGC
GTCGGCAATGTAATTTTTTCAAATCTCAGGAGGCCCCTAACTACAGCGTATCGGCTGTAGAATCGCTATATGATTAATTTTGTTATTTACAAGTCGAACT
ACTGTCTAATTTGTCTGGCACGCATGAAGGACGCTGCGGCAAAGAAGTTTGAACACTTCATGGCATGCTTCAAACGTAAATTCGAGCGCAGTATCGCTGT
TATTAGGACATATGGCGGAGGTGAGCATCAAAACGTTGATATTTTCTGTATAAAAACTAAAATAGAAAGGCAAATG