Description :
From Genome Similarity Track
Location :
Scaffold_2001:21- 1791
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2001-snap-gene-0.1Stage II sporulation E family protein

Sequence
1770 bases(100 bases per row)
GTGCATCAATCCATTCCAGCGCTGTAACAACAGCGGATCGCTCATTCCCGCTTTTCCCTCCTCTCCATCAAGAAGACCCCCCACCGTCCCTCAAGCACCT
CACCATGTCGGACCTTAAGGCTCAATTCGAAGCTGCCGCCGCGCTCGCCAAGACCTTCACCAAGGAGCNNNNNNNNNNACGAACGACGAGAAGCTCACGT
TGTACGCCTACTACAAGCAGGCCACCGTCGGCGACAACAACACCGCCAAGCCAGGCATGTTCGACTTGACCGGCAAGGCCAAGTGGGCCGCGTGGGCCGA
AAAGAAGGGCGTCTCGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNCATGCAGAAGTACATTGAAGAAATCGAGAAGCAGAAGGCCATCTACGCGTAAGCA
TTTCGTGTGATGCCACCCTTTTTGCGTGTCGTTTTCGGTCTCTTTTGCATTGACGCGGTCGAAGATGAAGTCAGAGTCTCTCGATTGAGAGAAAGACGGA
CGCTGCTGCTCTCTTTGCCAGTGCAGTAAAGTCCCTCCTCGTTCGTCTAGGCTCGGCGTATCTCGGGAACACGTTTTGAATAAGTACCAAAAAGTAAATA
TATATGATGCGAAATTGATCTTGACCCGATTGCCGCCGTAATGGCGCGCTTAAATGGCTTGTCGTACTTGTTCCAAGATGAATGCAATGAAGACGAGCAA
CTCTTATGATACGTTGCGGAACTGATATCATTTGCATTCCATTCGTAGTCGCTTACGCGCCATTTTCAAAATCTATAGGGAATCGTTCACACACACACAC
ACACTTACTATACTGTCGACGTGGGGTTCACTACTACCACTTTCACTGACACGCATAACTGCACACACATTGCGCGATCTCTTCATAATACATATTGCTC
CTGCGTTTTTGCCACCACAGTCGAGAAAAACTCACTTGGTCTGCGCCTCAATCTTGGCCTCCATGCGCGCAAAGTTCGTCATGAGCTTGTTAATCTGCGT
CGAGTGATAGCCGAGCGTGTGGGAGATCGACATCTGCTGCGTCGCCAATTGATGCTGCGTCTCGGTGTTTTGTGTCAGCAGGCGCATCAAGAGTGCCTCC
ATGGGCTCGCCGCCAGGCGACGCAGTGCCCATCACCAACGCGTCGGAAAACGAGTTGTTGTTGACAGGCGATGGAGGGACTTGCTTGCCCGCATTGACGA
CGCGATTCGCAGGGGAAGGAGGAGACACTTCCGTTGACGAATAGCAGTTGTCAAGTTGCTTTGAAGGCTTCGCAATGGAGATTGGTGATACTTTCGCAAG
CAAATCGTCCTGTTCCGGCGTCTCCTTGACAACTCTCGGCAGGTTCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGA
CTCGCGCGGGCGCTTATCAAGTACAAACACACTTCCGACGGCGTGGCCACTCGAAGGGTCGAGGATCGGCGCGGCCGCGTAGAAGCGGNNNNNNNNNNNN
CTGCACCAGAGACCAATGGATTGCTCTCAAAGCGCTTGTCCTTGAGCATGTCGAGCACGACCACGGGCTCCTTCGTGAACACCGTGTAGGCGCAGAATGA
GATCTTGCGTGGGATATTCTTGTGCGCCAAGCCCACGCTTGCCTTGAACCACTGCTTCTGCTCGCCCATGAAGCTCACAGCGGCCATGGGGCACGACAGA
CGCGCCTTGGCAAGGTCGCAGATCATGTCATAGGGCTTCTCGGGAGGACTGTCCAGCACGTCAAGCGCAT