Description :
From Genome Similarity Track
Location :
Scaffold_649:21- 1692
Transcript NameFunction/comments
Aphas_H257_19456arthrofactin synthetase C

Sequence
1671 bases(100 bases per row)
TCGTCGGAATTGATCATGCAATGCCCTTGTATGGACGTTCGATTGGCTTGCAACTGCTGCAGTCGCTCCACAATCGACATCTCGGTATCGAATTTAACCC
GACACGGCACTTCGCTCACAGTGCACCCGAGCATCCTACTCCCCAAAACGTTAGTGTCAACTCCCAAATGAGGTGGTCGTACTGGTCGATCCCGTGCACG
TCGAGGTTGCGGTTGGCCAGCACTTGCCCAAACACGATGTCGTGTCGGTTTGTGTGGTGCTGCAGCGCCATGGCCCAACTGAGGAGCACCACGGTGGACA
TGGTCACGCCAAGACTCCGGATGACCGAGGGAAGGCGAGGCAAGGCGGCGTGTGTAGCCAGCGACAGGTCGTTGGGTTCAGGACACGATGTTGGAGGCAC
CAAGTCGGACAAACAGGGCGTCGGTGGTGCTCCCGCGAGGTAATTGGCCCAAAACGCTACTGTTTTCGTCATGTCGTGACTGGCCAGGTGTTGGATCAGC
GCTCGAAAAGACGGACGCTGCGACACTGGGTGGCCAGAGTACGTATCGAACAAATCCGATCGCAACAGCGAAATGGACCAGCCGTCGTACAAGGCATGGT
GGATGGTCAGAACGCCCACAGAATCGCCTCCACAGGTAACCACCGTGAACCGAGCAAACGACGGATCGGCCAGTGTAAACCCTCGGGCTTTGTCCGTGGC
CAAGAATTCACTCAATGAAGTGGCTGAAGAATACTCGATAGACGACGACGTAGCTGGGTTGACGACATGGTAGACTCCGATGGGGTTGCTGACAAACGTC
GTCCGCAACGTCTCGCATGTCGCGGCCAACTGGCCATACGCGACTGCCATCTTGGCGGCACCCCATTCGAGAAACGGCACTTGAAGCACCCAATTTGACG
GGATTCGGATGGTCGATTGTACTAGAAACGATTGCTCGGGTGTCGTGGCAAATGCCGATTCATAGGTAGGCCAGTGCGACATGATTTCCTGGATGACTTC
CGTGGAGAGTGCCACGTCTGACACCACCGGAAGGTGCAGAGGGGGCTGGCTCTTGGCTTCGGTTGCAAGGTCACACAAGCGCCCAGACGCGAGGATGTCA
CGCACAGATACACGCCATCCACGTTGCTTCAACGCAGCTGCGAGGTAAATGGCCGTGATGGAATCGCCCCCCAGCGCCACGAACGACGAGTGTCGGCCGA
TCTCACTCTGGTTGACCTTGAGAACTGTTGAGATGATGGCTGCCAGTTCAATCTCCAGCTCAGTCTGCATGGGCTCCATGGTCAAGGTAGCCTCCAACCC
CGCCAGTGCCAACTTGTCCACTTTGCCATTGCAGTTATGCGGCAGCATGTCCAGACCAACCCACATCGCAGGCACCATATACACGGGCAATAGGTCGGCC
ACCGTTTGCCGCAAGCCTTCGACATTGACGGTGGCGGGCGTGAAATACCCGACGAGATGGGACTTGTCCTTGACGACGACCGCGGCCGACACTATCTCAG
GGTGGTGCATCATCGCATTGGCCACTTCGTCCAACTCGATGCGGTACCCCTTCAACTTGACCTGGCTGTCCATGCGACCGAGGATTTCAAACTGGCCGTT
GGGCAAAAGTCGGCCCAAGTCTCCCGTTCGATACATCATCCCAGAATCATTCGTAAACGGATCCTTCAGAA