Description :
From Genome Similarity Track
Location :
Scaffold_2140:21- 1535
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_2140-snap-gene-0.1Lysosomal alpha-mannosidase

Sequence
1514 bases(100 bases per row)
CGACTTCTTTCCGTTCGCGACTGGCGTAGATGATTACTGGTCGGGATTCTTCTCAAGCCGTCCGACTCTCAAGCGGTTCACACGCGTCTCGAACATTCTA
TTGCAACAAATCCGTCAGCTTAATGCAGTCTACCAGAGCAATCACTCGGTCGAGCTGGATGCACTGCAACGTGCAGTAGGTCTGGTTCAGCATCATGATG
GTTTGTCGGGTACGGAGAAGCAGGCCGTCGCGAATGATTATGCACTGCGCTTAAATGACGGTATCATCAAGGCGGAGGAGGGAATGAACCGGATTCTGTC
CGAGGCAGGCGCAAAGGAGCCATACCACTTGTGTCTGTTGGCGAACACGAGCGTCTGTGAAGTGTCGACCACAAACCAGGTATGCTTGATGGGTCCACGT
GCAACTCTTAGTTGGTATGTTGGCTCAACGATTTTGATTATCTAATTGGTCAGGAGTTTGAGGCGCTCGTCCACAACGCACTTCCTCGGAAGAGCGTCGA
GATAATATCGATCCCATTGGCGCATCCGGTAGCTACGGTGCAGATTATTGACGGCGGAGGTGTGATTCGTCGTCAAGATGTGTACAAGGCTCTGCCTGTG
CATCCCGTGTCAGCAGTCGCTCCGTATTCGCTGGTGTTCAGCGTTGAACTCCCCCCATTGAGCTTAACACGCTTTCATGTGAAGCAAGACAGACCCGCTG
ACTTCATAGGACTGCGTCCAAGCGAAGAATACACAAAGATGGAAGGCACGGCTGCAGACGACAAGGTTGTCACATTGGAGAACGAACTGATGCGCGTGGA
CATCGACGCGCAGACAGGGTTCATCAGAAAGCTGACCAACAAGAAGAAGAGGGTTGAGATGCCGCTCTCGGCAACCATGAGATACTATCACGCGTATCAG
CTGATGCAGCCGAGCTCAGGCGCGTACACGTTCCGACCGGACGGAAACAAAACCTACCCCGTCGGGCGAGCTGCGACAGAAAATCTGACTGCCACCCTGA
TCAATCTTGCGGTTGACTCGGATTCCGCTAGTGCGTCTCGCGTAGCGTTCAAGATTGGCGACTGGGTGACGTTGGAGTACCGGCTGAACGACGGCGACGA
GTTTGTTGAGATTGAGTGGACGGTTGGGCCAGTTCCCATCGACGACAATGTCGGAAAGGAGGTCATCTTCCACTTTGATACGGGAAACGCCATCAAGTCA
GACAAGGCATTCTTCACAGACTCGAATGGGCTGGAATTCATGAAACGAGTTCGCAATCACCGCGATACATGGAATCTCACGTTGCACGACGATGTGGAAC
GGGTTGCCGCCAACTATTTCCCCATCACGACGGGAGCTTACATCAAAGACTCGACTCGTCAGTTGAATGTTGTGACTGATCGAGCGCAGGGTGCGGCGAG
CCTCCAAGATGGTCAGTTTGAAGTGATGGTGCATCGACGACTATTGGCAGACGACAACAAAGGCGTCGCTGAACCGCTGAACGAGACCGAGTCGGTGTAT
GATGCATCGAAGAA